ID: 1176431321

View in Genome Browser
Species Human (GRCh38)
Location 21:6578173-6578195
Sequence CAGGCCTCCCTGAAAGTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176431321_1176431334 13 Left 1176431321 21:6578173-6578195 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1176431334 21:6578209-6578231 CCCTGGGAGGGATCTGAGGGAGG No data
1176431321_1176431328 0 Left 1176431321 21:6578173-6578195 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1176431328 21:6578196-6578218 GTGCCTGTTACATCCCTGGGAGG No data
1176431321_1176431337 27 Left 1176431321 21:6578173-6578195 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1176431337 21:6578223-6578245 TGAGGGAGGGCTCCATGCCCTGG No data
1176431321_1176431336 14 Left 1176431321 21:6578173-6578195 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1176431336 21:6578210-6578232 CCTGGGAGGGATCTGAGGGAGGG No data
1176431321_1176431326 -4 Left 1176431321 21:6578173-6578195 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1176431326 21:6578192-6578214 CCTGGTGCCTGTTACATCCCTGG No data
1176431321_1176431329 1 Left 1176431321 21:6578173-6578195 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1176431329 21:6578197-6578219 TGCCTGTTACATCCCTGGGAGGG No data
1176431321_1176431331 9 Left 1176431321 21:6578173-6578195 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1176431331 21:6578205-6578227 ACATCCCTGGGAGGGATCTGAGG No data
1176431321_1176431332 10 Left 1176431321 21:6578173-6578195 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1176431332 21:6578206-6578228 CATCCCTGGGAGGGATCTGAGGG No data
1176431321_1176431338 28 Left 1176431321 21:6578173-6578195 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1176431338 21:6578224-6578246 GAGGGAGGGCTCCATGCCCTGGG No data
1176431321_1176431327 -3 Left 1176431321 21:6578173-6578195 CCCCAAACTTTCAGGGAGGCCTG No data
Right 1176431327 21:6578193-6578215 CTGGTGCCTGTTACATCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176431321 Original CRISPR CAGGCCTCCCTGAAAGTTTG GGG (reversed) Intergenic
No off target data available for this crispr