ID: 1176435431

View in Genome Browser
Species Human (GRCh38)
Location 21:6670335-6670357
Sequence GGCCCATCCGGTCCTGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176435431_1176435441 6 Left 1176435431 21:6670335-6670357 CCAGGGACAGGACCGGATGGGCC No data
Right 1176435441 21:6670364-6670386 GACGTGGGGGTCCTCGCTGCTGG No data
1176435431_1176435437 -9 Left 1176435431 21:6670335-6670357 CCAGGGACAGGACCGGATGGGCC No data
Right 1176435437 21:6670349-6670371 GGATGGGCCGGACGGGACGTGGG No data
1176435431_1176435438 -8 Left 1176435431 21:6670335-6670357 CCAGGGACAGGACCGGATGGGCC No data
Right 1176435438 21:6670350-6670372 GATGGGCCGGACGGGACGTGGGG No data
1176435431_1176435439 -7 Left 1176435431 21:6670335-6670357 CCAGGGACAGGACCGGATGGGCC No data
Right 1176435439 21:6670351-6670373 ATGGGCCGGACGGGACGTGGGGG No data
1176435431_1176435436 -10 Left 1176435431 21:6670335-6670357 CCAGGGACAGGACCGGATGGGCC No data
Right 1176435436 21:6670348-6670370 CGGATGGGCCGGACGGGACGTGG No data
1176435431_1176435442 14 Left 1176435431 21:6670335-6670357 CCAGGGACAGGACCGGATGGGCC No data
Right 1176435442 21:6670372-6670394 GGTCCTCGCTGCTGGCCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176435431 Original CRISPR GGCCCATCCGGTCCTGTCCC TGG (reversed) Intergenic