ID: 1176435435

View in Genome Browser
Species Human (GRCh38)
Location 21:6670347-6670369
Sequence CACGTCCCGTCCGGCCCATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176435435_1176435451 30 Left 1176435435 21:6670347-6670369 CCGGATGGGCCGGACGGGACGTG No data
Right 1176435451 21:6670400-6670422 TTGCAGCCACAGGGGACTGAGGG No data
1176435435_1176435442 2 Left 1176435435 21:6670347-6670369 CCGGATGGGCCGGACGGGACGTG No data
Right 1176435442 21:6670372-6670394 GGTCCTCGCTGCTGGCCCAGCGG No data
1176435435_1176435441 -6 Left 1176435435 21:6670347-6670369 CCGGATGGGCCGGACGGGACGTG No data
Right 1176435441 21:6670364-6670386 GACGTGGGGGTCCTCGCTGCTGG No data
1176435435_1176435446 20 Left 1176435435 21:6670347-6670369 CCGGATGGGCCGGACGGGACGTG No data
Right 1176435446 21:6670390-6670412 AGCGGCCATCTTGCAGCCACAGG No data
1176435435_1176435448 22 Left 1176435435 21:6670347-6670369 CCGGATGGGCCGGACGGGACGTG No data
Right 1176435448 21:6670392-6670414 CGGCCATCTTGCAGCCACAGGGG No data
1176435435_1176435450 29 Left 1176435435 21:6670347-6670369 CCGGATGGGCCGGACGGGACGTG No data
Right 1176435450 21:6670399-6670421 CTTGCAGCCACAGGGGACTGAGG No data
1176435435_1176435447 21 Left 1176435435 21:6670347-6670369 CCGGATGGGCCGGACGGGACGTG No data
Right 1176435447 21:6670391-6670413 GCGGCCATCTTGCAGCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176435435 Original CRISPR CACGTCCCGTCCGGCCCATC CGG (reversed) Intergenic