ID: 1176435442

View in Genome Browser
Species Human (GRCh38)
Location 21:6670372-6670394
Sequence GGTCCTCGCTGCTGGCCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176435431_1176435442 14 Left 1176435431 21:6670335-6670357 CCAGGGACAGGACCGGATGGGCC No data
Right 1176435442 21:6670372-6670394 GGTCCTCGCTGCTGGCCCAGCGG No data
1176435430_1176435442 15 Left 1176435430 21:6670334-6670356 CCCAGGGACAGGACCGGATGGGC No data
Right 1176435442 21:6670372-6670394 GGTCCTCGCTGCTGGCCCAGCGG No data
1176435440_1176435442 -7 Left 1176435440 21:6670356-6670378 CCGGACGGGACGTGGGGGTCCTC No data
Right 1176435442 21:6670372-6670394 GGTCCTCGCTGCTGGCCCAGCGG No data
1176435435_1176435442 2 Left 1176435435 21:6670347-6670369 CCGGATGGGCCGGACGGGACGTG No data
Right 1176435442 21:6670372-6670394 GGTCCTCGCTGCTGGCCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176435442 Original CRISPR GGTCCTCGCTGCTGGCCCAG CGG Intergenic