ID: 1176436718

View in Genome Browser
Species Human (GRCh38)
Location 21:6679753-6679775
Sequence AGCATGGAGGCCAGGTGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176436718_1176436729 27 Left 1176436718 21:6679753-6679775 CCTCAGCACCTGGCCTCCATGCT No data
Right 1176436729 21:6679803-6679825 CAATGCCTCCCGCAACTCTCAGG No data
1176436718_1176436723 1 Left 1176436718 21:6679753-6679775 CCTCAGCACCTGGCCTCCATGCT No data
Right 1176436723 21:6679777-6679799 CTTTTTCCTCTGTTCAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176436718 Original CRISPR AGCATGGAGGCCAGGTGCTG AGG (reversed) Intergenic
No off target data available for this crispr