ID: 1176436719

View in Genome Browser
Species Human (GRCh38)
Location 21:6679761-6679783
Sequence GAAAAAGGAGCATGGAGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176436719_1176436733 29 Left 1176436719 21:6679761-6679783 CCTGGCCTCCATGCTCCTTTTTC No data
Right 1176436733 21:6679813-6679835 CGCAACTCTCAGGTCACCATTGG No data
1176436719_1176436729 19 Left 1176436719 21:6679761-6679783 CCTGGCCTCCATGCTCCTTTTTC No data
Right 1176436729 21:6679803-6679825 CAATGCCTCCCGCAACTCTCAGG No data
1176436719_1176436723 -7 Left 1176436719 21:6679761-6679783 CCTGGCCTCCATGCTCCTTTTTC No data
Right 1176436723 21:6679777-6679799 CTTTTTCCTCTGTTCAATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176436719 Original CRISPR GAAAAAGGAGCATGGAGGCC AGG (reversed) Intergenic
No off target data available for this crispr