ID: 1176436721

View in Genome Browser
Species Human (GRCh38)
Location 21:6679769-6679791
Sequence GAACAGAGGAAAAAGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176436721_1176436729 11 Left 1176436721 21:6679769-6679791 CCATGCTCCTTTTTCCTCTGTTC No data
Right 1176436729 21:6679803-6679825 CAATGCCTCCCGCAACTCTCAGG No data
1176436721_1176436733 21 Left 1176436721 21:6679769-6679791 CCATGCTCCTTTTTCCTCTGTTC No data
Right 1176436733 21:6679813-6679835 CGCAACTCTCAGGTCACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176436721 Original CRISPR GAACAGAGGAAAAAGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr