ID: 1176436725

View in Genome Browser
Species Human (GRCh38)
Location 21:6679795-6679817
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176436725_1176436733 -5 Left 1176436725 21:6679795-6679817 CCTGGCCCCAATGCCTCCCGCAA No data
Right 1176436733 21:6679813-6679835 CGCAACTCTCAGGTCACCATTGG No data
1176436725_1176436736 19 Left 1176436725 21:6679795-6679817 CCTGGCCCCAATGCCTCCCGCAA No data
Right 1176436736 21:6679837-6679859 GAAGATGCTCAGGAAGAACAAGG No data
1176436725_1176436734 9 Left 1176436725 21:6679795-6679817 CCTGGCCCCAATGCCTCCCGCAA No data
Right 1176436734 21:6679827-6679849 CACCATTGGAGAAGATGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176436725 Original CRISPR TTGCGGGAGGCATTGGGGCC AGG (reversed) Intergenic
No off target data available for this crispr