ID: 1176436729

View in Genome Browser
Species Human (GRCh38)
Location 21:6679803-6679825
Sequence CAATGCCTCCCGCAACTCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176436721_1176436729 11 Left 1176436721 21:6679769-6679791 CCATGCTCCTTTTTCCTCTGTTC No data
Right 1176436729 21:6679803-6679825 CAATGCCTCCCGCAACTCTCAGG No data
1176436719_1176436729 19 Left 1176436719 21:6679761-6679783 CCTGGCCTCCATGCTCCTTTTTC No data
Right 1176436729 21:6679803-6679825 CAATGCCTCCCGCAACTCTCAGG No data
1176436722_1176436729 4 Left 1176436722 21:6679776-6679798 CCTTTTTCCTCTGTTCAATCCTG No data
Right 1176436729 21:6679803-6679825 CAATGCCTCCCGCAACTCTCAGG No data
1176436720_1176436729 14 Left 1176436720 21:6679766-6679788 CCTCCATGCTCCTTTTTCCTCTG No data
Right 1176436729 21:6679803-6679825 CAATGCCTCCCGCAACTCTCAGG No data
1176436724_1176436729 -3 Left 1176436724 21:6679783-6679805 CCTCTGTTCAATCCTGGCCCCAA No data
Right 1176436729 21:6679803-6679825 CAATGCCTCCCGCAACTCTCAGG No data
1176436718_1176436729 27 Left 1176436718 21:6679753-6679775 CCTCAGCACCTGGCCTCCATGCT No data
Right 1176436729 21:6679803-6679825 CAATGCCTCCCGCAACTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176436729 Original CRISPR CAATGCCTCCCGCAACTCTC AGG Intergenic
No off target data available for this crispr