ID: 1176436732

View in Genome Browser
Species Human (GRCh38)
Location 21:6679812-6679834
Sequence CAATGGTGACCTGAGAGTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176436732_1176436737 26 Left 1176436732 21:6679812-6679834 CCGCAACTCTCAGGTCACCATTG No data
Right 1176436737 21:6679861-6679883 GCTGCAGTCAACCCTGCTGAAGG No data
1176436732_1176436734 -8 Left 1176436732 21:6679812-6679834 CCGCAACTCTCAGGTCACCATTG No data
Right 1176436734 21:6679827-6679849 CACCATTGGAGAAGATGCTCAGG No data
1176436732_1176436738 29 Left 1176436732 21:6679812-6679834 CCGCAACTCTCAGGTCACCATTG No data
Right 1176436738 21:6679864-6679886 GCAGTCAACCCTGCTGAAGGTGG No data
1176436732_1176436736 2 Left 1176436732 21:6679812-6679834 CCGCAACTCTCAGGTCACCATTG No data
Right 1176436736 21:6679837-6679859 GAAGATGCTCAGGAAGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176436732 Original CRISPR CAATGGTGACCTGAGAGTTG CGG (reversed) Intergenic
No off target data available for this crispr