ID: 1176436733

View in Genome Browser
Species Human (GRCh38)
Location 21:6679813-6679835
Sequence CGCAACTCTCAGGTCACCAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176436720_1176436733 24 Left 1176436720 21:6679766-6679788 CCTCCATGCTCCTTTTTCCTCTG No data
Right 1176436733 21:6679813-6679835 CGCAACTCTCAGGTCACCATTGG No data
1176436722_1176436733 14 Left 1176436722 21:6679776-6679798 CCTTTTTCCTCTGTTCAATCCTG No data
Right 1176436733 21:6679813-6679835 CGCAACTCTCAGGTCACCATTGG No data
1176436721_1176436733 21 Left 1176436721 21:6679769-6679791 CCATGCTCCTTTTTCCTCTGTTC No data
Right 1176436733 21:6679813-6679835 CGCAACTCTCAGGTCACCATTGG No data
1176436724_1176436733 7 Left 1176436724 21:6679783-6679805 CCTCTGTTCAATCCTGGCCCCAA No data
Right 1176436733 21:6679813-6679835 CGCAACTCTCAGGTCACCATTGG No data
1176436725_1176436733 -5 Left 1176436725 21:6679795-6679817 CCTGGCCCCAATGCCTCCCGCAA No data
Right 1176436733 21:6679813-6679835 CGCAACTCTCAGGTCACCATTGG No data
1176436726_1176436733 -10 Left 1176436726 21:6679800-6679822 CCCCAATGCCTCCCGCAACTCTC No data
Right 1176436733 21:6679813-6679835 CGCAACTCTCAGGTCACCATTGG No data
1176436719_1176436733 29 Left 1176436719 21:6679761-6679783 CCTGGCCTCCATGCTCCTTTTTC No data
Right 1176436733 21:6679813-6679835 CGCAACTCTCAGGTCACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176436733 Original CRISPR CGCAACTCTCAGGTCACCAT TGG Intergenic
No off target data available for this crispr