ID: 1176436734

View in Genome Browser
Species Human (GRCh38)
Location 21:6679827-6679849
Sequence CACCATTGGAGAAGATGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176436726_1176436734 4 Left 1176436726 21:6679800-6679822 CCCCAATGCCTCCCGCAACTCTC No data
Right 1176436734 21:6679827-6679849 CACCATTGGAGAAGATGCTCAGG No data
1176436731_1176436734 -7 Left 1176436731 21:6679811-6679833 CCCGCAACTCTCAGGTCACCATT No data
Right 1176436734 21:6679827-6679849 CACCATTGGAGAAGATGCTCAGG No data
1176436727_1176436734 3 Left 1176436727 21:6679801-6679823 CCCAATGCCTCCCGCAACTCTCA No data
Right 1176436734 21:6679827-6679849 CACCATTGGAGAAGATGCTCAGG No data
1176436725_1176436734 9 Left 1176436725 21:6679795-6679817 CCTGGCCCCAATGCCTCCCGCAA No data
Right 1176436734 21:6679827-6679849 CACCATTGGAGAAGATGCTCAGG No data
1176436724_1176436734 21 Left 1176436724 21:6679783-6679805 CCTCTGTTCAATCCTGGCCCCAA No data
Right 1176436734 21:6679827-6679849 CACCATTGGAGAAGATGCTCAGG No data
1176436722_1176436734 28 Left 1176436722 21:6679776-6679798 CCTTTTTCCTCTGTTCAATCCTG No data
Right 1176436734 21:6679827-6679849 CACCATTGGAGAAGATGCTCAGG No data
1176436728_1176436734 2 Left 1176436728 21:6679802-6679824 CCAATGCCTCCCGCAACTCTCAG No data
Right 1176436734 21:6679827-6679849 CACCATTGGAGAAGATGCTCAGG No data
1176436730_1176436734 -4 Left 1176436730 21:6679808-6679830 CCTCCCGCAACTCTCAGGTCACC No data
Right 1176436734 21:6679827-6679849 CACCATTGGAGAAGATGCTCAGG No data
1176436732_1176436734 -8 Left 1176436732 21:6679812-6679834 CCGCAACTCTCAGGTCACCATTG No data
Right 1176436734 21:6679827-6679849 CACCATTGGAGAAGATGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176436734 Original CRISPR CACCATTGGAGAAGATGCTC AGG Intergenic
No off target data available for this crispr