ID: 1176439778

View in Genome Browser
Species Human (GRCh38)
Location 21:6712726-6712748
Sequence AATGGTGACCTGAGAGTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176439772_1176439778 30 Left 1176439772 21:6712673-6712695 CCACCTTCAGCAGGGTTGACTGC No data
Right 1176439778 21:6712726-6712748 AATGGTGACCTGAGAGTTGCGGG No data
1176439775_1176439778 -7 Left 1176439775 21:6712710-6712732 CCTGAGCATCTTCTCCAATGGTG No data
Right 1176439778 21:6712726-6712748 AATGGTGACCTGAGAGTTGCGGG No data
1176439773_1176439778 27 Left 1176439773 21:6712676-6712698 CCTTCAGCAGGGTTGACTGCAGC No data
Right 1176439778 21:6712726-6712748 AATGGTGACCTGAGAGTTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176439778 Original CRISPR AATGGTGACCTGAGAGTTGC GGG Intergenic
No off target data available for this crispr