ID: 1176440201

View in Genome Browser
Species Human (GRCh38)
Location 21:6715163-6715185
Sequence AAGTAGACACAAATCCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176440201_1176440205 9 Left 1176440201 21:6715163-6715185 CCCATGGGGATTTGTGTCTACTT No data
Right 1176440205 21:6715195-6715217 TGCTCATCTCAGTACACTACAGG No data
1176440201_1176440208 27 Left 1176440201 21:6715163-6715185 CCCATGGGGATTTGTGTCTACTT No data
Right 1176440208 21:6715213-6715235 ACAGGTGACTGTGCCGAGGTGGG No data
1176440201_1176440207 26 Left 1176440201 21:6715163-6715185 CCCATGGGGATTTGTGTCTACTT No data
Right 1176440207 21:6715212-6715234 TACAGGTGACTGTGCCGAGGTGG No data
1176440201_1176440206 23 Left 1176440201 21:6715163-6715185 CCCATGGGGATTTGTGTCTACTT No data
Right 1176440206 21:6715209-6715231 CACTACAGGTGACTGTGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176440201 Original CRISPR AAGTAGACACAAATCCCCAT GGG (reversed) Intergenic
No off target data available for this crispr