ID: 1176440548

View in Genome Browser
Species Human (GRCh38)
Location 21:6717534-6717556
Sequence ATGTGAAAAGAGCTGGTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176440548_1176440556 30 Left 1176440548 21:6717534-6717556 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176440556 21:6717587-6717609 TCCAGAAGTCACACTGCGCTGGG No data
1176440548_1176440555 29 Left 1176440548 21:6717534-6717556 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176440555 21:6717586-6717608 CTCCAGAAGTCACACTGCGCTGG No data
1176440548_1176440554 0 Left 1176440548 21:6717534-6717556 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176440554 21:6717557-6717579 CATTTGAGGTAAGACGATGGGGG No data
1176440548_1176440552 -2 Left 1176440548 21:6717534-6717556 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176440552 21:6717555-6717577 ATCATTTGAGGTAAGACGATGGG No data
1176440548_1176440551 -3 Left 1176440548 21:6717534-6717556 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176440551 21:6717554-6717576 CATCATTTGAGGTAAGACGATGG No data
1176440548_1176440553 -1 Left 1176440548 21:6717534-6717556 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176440553 21:6717556-6717578 TCATTTGAGGTAAGACGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176440548 Original CRISPR ATGTGAAAAGAGCTGGTTCC CGG (reversed) Intergenic
No off target data available for this crispr