ID: 1176441065

View in Genome Browser
Species Human (GRCh38)
Location 21:6722117-6722139
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 6, 1: 5, 2: 2, 3: 14, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176441065_1176441073 2 Left 1176441065 21:6722117-6722139 CCGCTGGGCCAGCATCGAGGACC 0: 6
1: 5
2: 2
3: 14
4: 111
Right 1176441073 21:6722142-6722164 CACATCCGGCCTGGCCCATCCGG 0: 6
1: 0
2: 0
3: 15
4: 129
1176441065_1176441076 14 Left 1176441065 21:6722117-6722139 CCGCTGGGCCAGCATCGAGGACC 0: 6
1: 5
2: 2
3: 14
4: 111
Right 1176441076 21:6722154-6722176 GGCCCATCCGGTGCTGTCCCTGG 0: 6
1: 7
2: 2
3: 10
4: 98
1176441065_1176441068 -7 Left 1176441065 21:6722117-6722139 CCGCTGGGCCAGCATCGAGGACC 0: 6
1: 5
2: 2
3: 14
4: 111
Right 1176441068 21:6722133-6722155 GAGGACCCCCACATCCGGCCTGG 0: 6
1: 0
2: 0
3: 13
4: 140
1176441065_1176441077 15 Left 1176441065 21:6722117-6722139 CCGCTGGGCCAGCATCGAGGACC 0: 6
1: 5
2: 2
3: 14
4: 111
Right 1176441077 21:6722155-6722177 GCCCATCCGGTGCTGTCCCTGGG 0: 6
1: 7
2: 0
3: 13
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176441065 Original CRISPR GGTCCTCGATGCTGGCCCAG CGG (reversed) Intergenic
900500207 1:3000788-3000810 GGTCCTCGCTGCTGGCTCGCTGG - Intergenic
902711746 1:18244648-18244670 GGTGCTGGATGCTGCCACAGAGG + Intronic
903891685 1:26574146-26574168 AGTCATCCATCCTGGCCCAGCGG + Exonic
906688037 1:47775171-47775193 TGTCCTCGATGCGGACCCAGAGG + Exonic
907800186 1:57757171-57757193 GGTCCATGCTGCTGGCCCAGGGG + Intronic
924844288 1:247749898-247749920 GGTCTCAGATGCTGGCCTAGTGG - Intergenic
1063584540 10:7339904-7339926 GATGCTAAATGCTGGCCCAGAGG + Intronic
1066059193 10:31707315-31707337 TGACCTCGATGGTGGGCCAGGGG - Intergenic
1070559240 10:77553451-77553473 GGTGCTCACTGCTGACCCAGTGG - Intronic
1072621684 10:97083953-97083975 GCTCCTGGGTGGTGGCCCAGAGG - Intronic
1075485904 10:122821957-122821979 GGTCTTCCCTGATGGCCCAGAGG - Intergenic
1075545251 10:123350369-123350391 GGTCCTCTGTGCTGGCTCACGGG - Intergenic
1076555202 10:131316869-131316891 GGACCTCGATGCTGGGGCAGAGG - Intergenic
1077458062 11:2692746-2692768 GGTACTAGACCCTGGCCCAGAGG - Intronic
1077759768 11:5081072-5081094 GGTCCTCTATTCTGTCCCATTGG - Intergenic
1079502593 11:21118329-21118351 GGTCCTTGAATCTGGCCTAGAGG - Intronic
1083083214 11:60114710-60114732 GGTCCTGCATGCTGCCCCTGGGG - Intergenic
1083868533 11:65471994-65472016 GGGCCAGGATGCTGGCCCTGGGG + Intergenic
1084302713 11:68261903-68261925 GCTCCTGGGTGTTGGCCCAGTGG + Exonic
1088691599 11:112333169-112333191 GGTACTCGTTGCTGGCTCTGAGG - Intergenic
1102823561 12:115927597-115927619 AGTCTTCCATGCTGGCCCTGGGG - Intergenic
1103347261 12:120259602-120259624 GGCCTTGGATGCTGGGCCAGTGG - Intronic
1104242802 12:127007345-127007367 CGACCTCGATGCAGGCTCAGCGG + Intergenic
1104873990 12:132020155-132020177 CGTCCTCGAAGCGGGCCCTGTGG - Exonic
1104968964 12:132522618-132522640 GGCGCTCCATGCTGGCCCACAGG + Intronic
1111606411 13:90545632-90545654 TTTCCTGGATGCTGGCCAAGAGG - Intergenic
1113375756 13:109764300-109764322 GTTCCTAGATGCTAGCCCTGGGG - Intronic
1113950452 13:114068599-114068621 GGTCGTGGGTGCCGGCCCAGGGG + Intronic
1114649889 14:24277809-24277831 GGTGCTGGATGCTGGCCTTGTGG + Intergenic
1115113333 14:29850908-29850930 GGTCCTCTATTCTGTCCCATTGG - Intronic
1118320994 14:64753375-64753397 AGCCCTCGGGGCTGGCCCAGAGG + Intronic
1121741098 14:96252884-96252906 GGTCCTGGGTGCTGGCTCTGGGG - Intronic
1128142629 15:65312776-65312798 TGTCCTGGAGCCTGGCCCAGCGG - Intergenic
1130991185 15:88877095-88877117 GGTCCTGGGTGCTGGCCTAGTGG - Intergenic
1132254142 15:100360371-100360393 GGTCCTCTATGCTGTTCCATAGG - Intergenic
1132395298 15:101468700-101468722 CGTCCTTGATGCTGGGCCAGTGG + Intronic
1133268868 16:4600649-4600671 GGACCCCCATGCTGACCCAGTGG + Exonic
1133777176 16:8905935-8905957 GGAGCTCGGTGCTGGCCCTGTGG + Intronic
1135506034 16:23037181-23037203 GGCCCTGGATGATGGCACAGAGG - Intergenic
1137442881 16:48511143-48511165 GGCCCCTGATGCTGGGCCAGAGG + Intergenic
1137926286 16:52545887-52545909 GGTCCTCGAAGTTGGCGCAGGGG + Intronic
1140230383 16:73112844-73112866 GGTCCTAGCTGCTGCCCCTGGGG + Intergenic
1141446237 16:84060472-84060494 GGTCCTCGATCATGGCCCTCTGG + Intronic
1143188024 17:5022298-5022320 GGTCAGCCATGGTGGCCCAGCGG - Exonic
1143205585 17:5137839-5137861 GATCCTCTGTTCTGGCCCAGAGG + Intronic
1144099034 17:11927796-11927818 GATCCTCGAGGCTGCCCCACAGG - Intronic
1144876626 17:18400527-18400549 GATCCTCTGTTCTGGCCCAGAGG + Intergenic
1145155600 17:20543893-20543915 GATCCTCTGTTCTGGCCCAGAGG - Intergenic
1146855343 17:36255897-36255919 GATCCTCTGTTCTGGCCCAGAGG - Intronic
1146871249 17:36379808-36379830 GATCCTCTGTTCTGGCCCAGAGG - Intronic
1146878609 17:36430890-36430912 GATCCTCTGTTCTGGCCCAGAGG - Intronic
1147068138 17:37933072-37933094 GATCCTCTGTTCTGGCCCAGAGG + Intronic
1147074135 17:37980432-37980454 GATCCTCTGTTCTGGCCCAGAGG - Intronic
1147079668 17:38012627-38012649 GATCCTCTGTTCTGGCCCAGAGG + Intronic
1147085657 17:38059970-38059992 GATCCTCTGTTCTGGCCCAGAGG - Intronic
1147095609 17:38136569-38136591 GATCCTCTGTTCTGGCCCAGAGG + Intergenic
1147101604 17:38183936-38183958 GATCCTCTGTTCTGGCCCAGAGG - Intergenic
1149846202 17:60010442-60010464 GATCCTCTGTTCTGGCCCAGAGG - Intergenic
1150084551 17:62267022-62267044 GATCCTCTGTTCTGGCCCAGAGG - Intergenic
1150211982 17:63446582-63446604 GGCCCTCGAGGCAGGCCCGGGGG - Intergenic
1150215610 17:63467300-63467322 GGTCCTCCATGCTTCCCCGGGGG + Intergenic
1152091905 17:78251906-78251928 GGTCCCTGACGCTGGCCCAGAGG + Intergenic
1152555332 17:81050136-81050158 AGGCCTCTCTGCTGGCCCAGCGG + Intronic
1203170046 17_GL000205v2_random:140423-140445 GGCCCTCGCTGCTGGCCCAGCGG + Intergenic
1158447476 18:57533711-57533733 GGGCCTACATGCTGGCACAGCGG - Intergenic
1160570051 18:79810002-79810024 GCTCCGCGAGGCTGGCCCTGTGG - Intergenic
1161412408 19:4123861-4123883 GAGCCCCGATGCTGGCCCGGAGG - Exonic
1162913434 19:13862074-13862096 ATTCCTGGATCCTGGCCCAGTGG - Intronic
1163021372 19:14482640-14482662 GGTCCCTGATGGTGGACCAGAGG - Intronic
1163516026 19:17764369-17764391 TCTCCTCGATGGTGGCCCTGGGG - Exonic
1163731584 19:18952720-18952742 GGTCCTGGATGCTGGCCTCCGGG + Intergenic
1166782835 19:45351321-45351343 GGTCCTGGGTGCTGGCGCTGAGG - Exonic
1167595185 19:50423715-50423737 GGCCCTCGTGGCTGGCCCCGAGG + Exonic
933719114 2:85385650-85385672 GGTCGTAGATGATGGGCCAGAGG + Intronic
940849970 2:158678753-158678775 GGTCCTAGATGCTTTCCCTGGGG + Intronic
946313023 2:218893284-218893306 GGACCTCGATCAGGGCCCAGGGG - Exonic
947495400 2:230632441-230632463 GGTTCTAGATGCTTACCCAGAGG - Intergenic
1172962096 20:38806507-38806529 GCTCATCGATTCCGGCCCAGAGG + Intronic
1175262347 20:57682471-57682493 GGTCCTAGGCGCCGGCCCAGAGG + Intronic
1175448126 20:59040432-59040454 AGACCTCGATGCTGCGCCAGTGG - Intronic
1176206534 20:63891674-63891696 GGTCCTCAATGCTGGGACAAGGG + Intergenic
1176326042 21:5502219-5502241 GGTCCTCGCTGCTGGCCCAGCGG + Intergenic
1176331665 21:5553964-5553986 GGTCCTCGATGCTGGCCCAGCGG - Intergenic
1176396092 21:6266987-6267009 GGTCCTCGATGCTGGCCCAGCGG + Intergenic
1176401715 21:6318732-6318754 GGTCCTCGCTGCTGGCCCAGCGG - Intergenic
1176435442 21:6670372-6670394 GGTCCTCGCTGCTGGCCCAGCGG + Intergenic
1176441065 21:6722117-6722139 GGTCCTCGATGCTGGCCCAGCGG - Intergenic
1176459704 21:6997442-6997464 GGTCCTCGCTGCTGGCCCAGCGG + Intergenic
1176465327 21:7049186-7049208 GGTCCTCGATGCTGGCCCAGCGG - Intronic
1176483265 21:7379220-7379242 GGTCCTCGCTGCTGGCCCAGCGG + Intergenic
1176488888 21:7430964-7430986 GGTCCTCGATGCTGGCCCAGCGG - Intergenic
1180800706 22:18630606-18630628 AGTCCTCGAAGCTGGCTCAGGGG - Intergenic
1180851938 22:19026163-19026185 AGTCCTCGAAGCTGGCTCAGGGG - Intergenic
1181221013 22:21364656-21364678 AGTCCTCGAAGCTGGCTCAGGGG + Intergenic
952037584 3:29221220-29221242 GCTCCTGGAAGCTGGCACAGAGG + Intergenic
954108717 3:48422653-48422675 GGTCATCTCTCCTGGCCCAGGGG + Intronic
954292942 3:49659282-49659304 GGTCCTGGCTGCAGGCACAGAGG + Intronic
960247148 3:115412376-115412398 GTTCCTAGATTCTGGCCCAGTGG - Intergenic
969291655 4:6243918-6243940 GGTCCTGGAGGCTGGTCCTGGGG - Intergenic
969456120 4:7300677-7300699 GGGCATGGATGCTGGACCAGGGG - Intronic
970399387 4:15703137-15703159 GTTCCCCGATGGCGGCCCAGGGG + Exonic
972982855 4:44726488-44726510 GTTCTTCGATGCTGGAACAGCGG + Exonic
979374983 4:119935946-119935968 GGTCCCCGATTCTGGGCCATTGG + Intergenic
996862773 5:128084119-128084141 GGTCCGCGATGAGGGCCCCGCGG + Exonic
1001158819 5:169296557-169296579 TGTCCTCTAAGCTGGCCCTGAGG + Intronic
1002337466 5:178489759-178489781 GCTCCTCGATACAGACCCAGAGG + Intronic
1003605225 6:7553798-7553820 GCTCCTCCAGGCAGGCCCAGGGG - Intronic
1005953510 6:30647821-30647843 GGTCCCCGATGGTGTCCTAGAGG - Exonic
1006456735 6:34136284-34136306 GCTCCTCTGTGCTGGCCCAGAGG + Intronic
1007699606 6:43758984-43759006 GCTCCTCGAAGCTGCCCAAGAGG - Intergenic
1013174692 6:107667395-107667417 GATCCTCGGGGCTGCCCCAGGGG + Intergenic
1013260038 6:108432719-108432741 GGTTCTCAATCCTGGCCCATTGG + Intronic
1018550737 6:164995637-164995659 GGTTCTCTATGCTGGTCCATTGG - Intergenic
1020004036 7:4772215-4772237 GGTACTCGTTGCTGCCCCAGTGG + Intronic
1030087500 7:105829514-105829536 CTTCCTCCATGCTGGCCCATAGG - Intronic
1034337136 7:150330877-150330899 GGGCCTTCCTGCTGGCCCAGAGG + Exonic
1035241546 7:157533862-157533884 GGTCCTGGATAAGGGCCCAGGGG - Intergenic
1035703230 8:1653279-1653301 GGTTCTTGGTGCTGGCCCTGCGG + Intronic
1036431681 8:8697978-8698000 GGTACTGGTTGGTGGCCCAGGGG - Intergenic
1036665015 8:10732309-10732331 GTTCCAGGATGCTGCCCCAGCGG - Intronic
1038237948 8:25779397-25779419 GGTCCTCTATTCTGGTCCATTGG + Intergenic
1040610246 8:48976733-48976755 GCTGCTTGCTGCTGGCCCAGCGG - Intergenic
1041658276 8:60375913-60375935 GGGCCCAGATGCAGGCCCAGAGG + Intergenic
1047747017 8:127852848-127852870 GGCCCTCGAGGTAGGCCCAGAGG + Intergenic
1047927202 8:129693398-129693420 TGTCCTCCACCCTGGCCCAGAGG - Intergenic
1048441424 8:134462262-134462284 GGTCCTCGGTGCTGGCACATGGG + Intergenic
1049127316 8:140803783-140803805 GATTCTCCATGCTGCCCCAGGGG + Intronic
1049642104 8:143720463-143720485 GCTCCTAGAGGGTGGCCCAGAGG + Intronic
1056827595 9:89887518-89887540 GGCCTTGGATGCTAGCCCAGAGG - Intergenic
1057819802 9:98322137-98322159 GGCCCTCTGGGCTGGCCCAGAGG + Intronic
1057863006 9:98656924-98656946 GGCCCTAGATGCTGGATCAGAGG + Intronic
1059424178 9:114210589-114210611 GGACCTCCAGGCTGGGCCAGGGG - Intronic
1061683710 9:132258261-132258283 GGTCCTAGATGCTTTCCCTGGGG - Intergenic
1062476137 9:136728397-136728419 GGCCCTGGCTGCTGGCCCCGTGG - Intergenic
1062516709 9:136940569-136940591 GGCCCTGGACGGTGGCCCAGTGG - Exonic
1203430434 Un_GL000195v1:86370-86392 GGTCCTCGATGCTGGCCCAGCGG + Intergenic
1203436087 Un_GL000195v1:138268-138290 GGCCCTCGCTGCTGGCCCAGCGG - Intergenic
1186515845 X:10165550-10165572 GGTCCTGGGTGCTGGGCCTGCGG + Intronic