ID: 1176454611

View in Genome Browser
Species Human (GRCh38)
Location 21:6897979-6898001
Sequence CATCCAGGAGCAGCCCGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176454598_1176454611 28 Left 1176454598 21:6897928-6897950 CCCGTTGCTCCCGGCCAGCGTGA No data
Right 1176454611 21:6897979-6898001 CATCCAGGAGCAGCCCGGCCAGG No data
1176454607_1176454611 -4 Left 1176454607 21:6897960-6897982 CCAACATCGTGGAGTACCTCATC No data
Right 1176454611 21:6897979-6898001 CATCCAGGAGCAGCCCGGCCAGG No data
1176454597_1176454611 29 Left 1176454597 21:6897927-6897949 CCCCGTTGCTCCCGGCCAGCGTG No data
Right 1176454611 21:6897979-6898001 CATCCAGGAGCAGCCCGGCCAGG No data
1176454599_1176454611 27 Left 1176454599 21:6897929-6897951 CCGTTGCTCCCGGCCAGCGTGAC No data
Right 1176454611 21:6897979-6898001 CATCCAGGAGCAGCCCGGCCAGG No data
1176454604_1176454611 14 Left 1176454604 21:6897942-6897964 CCAGCGTGACGGGCCACACCAAC No data
Right 1176454611 21:6897979-6898001 CATCCAGGAGCAGCCCGGCCAGG No data
1176454602_1176454611 19 Left 1176454602 21:6897937-6897959 CCCGGCCAGCGTGACGGGCCACA No data
Right 1176454611 21:6897979-6898001 CATCCAGGAGCAGCCCGGCCAGG No data
1176454606_1176454611 1 Left 1176454606 21:6897955-6897977 CCACACCAACATCGTGGAGTACC No data
Right 1176454611 21:6897979-6898001 CATCCAGGAGCAGCCCGGCCAGG No data
1176454603_1176454611 18 Left 1176454603 21:6897938-6897960 CCGGCCAGCGTGACGGGCCACAC No data
Right 1176454611 21:6897979-6898001 CATCCAGGAGCAGCCCGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176454611 Original CRISPR CATCCAGGAGCAGCCCGGCC AGG Intergenic
No off target data available for this crispr