ID: 1176456333

View in Genome Browser
Species Human (GRCh38)
Location 21:6915581-6915603
Sequence AGGAATAGGGAGAAAGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176456333_1176456339 18 Left 1176456333 21:6915581-6915603 CCTGCCTCTTTCTCCCTATTCCT No data
Right 1176456339 21:6915622-6915644 TTTGCATTGTCTTTGCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176456333 Original CRISPR AGGAATAGGGAGAAAGAGGC AGG (reversed) Intergenic
No off target data available for this crispr