ID: 1176456405

View in Genome Browser
Species Human (GRCh38)
Location 21:6916177-6916199
Sequence TCACTGAAGCAGCTCTTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176456397_1176456405 19 Left 1176456397 21:6916135-6916157 CCTGGCCAGGCAGTGATGTGGCA No data
Right 1176456405 21:6916177-6916199 TCACTGAAGCAGCTCTTGCTGGG No data
1176456399_1176456405 14 Left 1176456399 21:6916140-6916162 CCAGGCAGTGATGTGGCAGTGGC No data
Right 1176456405 21:6916177-6916199 TCACTGAAGCAGCTCTTGCTGGG No data
1176456394_1176456405 23 Left 1176456394 21:6916131-6916153 CCCACCTGGCCAGGCAGTGATGT No data
Right 1176456405 21:6916177-6916199 TCACTGAAGCAGCTCTTGCTGGG No data
1176456393_1176456405 24 Left 1176456393 21:6916130-6916152 CCCCACCTGGCCAGGCAGTGATG No data
Right 1176456405 21:6916177-6916199 TCACTGAAGCAGCTCTTGCTGGG No data
1176456392_1176456405 25 Left 1176456392 21:6916129-6916151 CCCCCACCTGGCCAGGCAGTGAT No data
Right 1176456405 21:6916177-6916199 TCACTGAAGCAGCTCTTGCTGGG No data
1176456395_1176456405 22 Left 1176456395 21:6916132-6916154 CCACCTGGCCAGGCAGTGATGTG No data
Right 1176456405 21:6916177-6916199 TCACTGAAGCAGCTCTTGCTGGG No data
1176456391_1176456405 28 Left 1176456391 21:6916126-6916148 CCACCCCCACCTGGCCAGGCAGT No data
Right 1176456405 21:6916177-6916199 TCACTGAAGCAGCTCTTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176456405 Original CRISPR TCACTGAAGCAGCTCTTGCT GGG Intergenic
No off target data available for this crispr