ID: 1176457823

View in Genome Browser
Species Human (GRCh38)
Location 21:6928780-6928802
Sequence CTCTGGGGACGGAGAGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176457810_1176457823 13 Left 1176457810 21:6928744-6928766 CCCAGCTGCTCCAAACCCAGGCA No data
Right 1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG No data
1176457812_1176457823 3 Left 1176457812 21:6928754-6928776 CCAAACCCAGGCAGCCCACTGCC No data
Right 1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG No data
1176457808_1176457823 17 Left 1176457808 21:6928740-6928762 CCTACCCAGCTGCTCCAAACCCA No data
Right 1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG No data
1176457805_1176457823 24 Left 1176457805 21:6928733-6928755 CCCTCGCCCTACCCAGCTGCTCC No data
Right 1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG No data
1176457806_1176457823 23 Left 1176457806 21:6928734-6928756 CCTCGCCCTACCCAGCTGCTCCA No data
Right 1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG No data
1176457811_1176457823 12 Left 1176457811 21:6928745-6928767 CCAGCTGCTCCAAACCCAGGCAG No data
Right 1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG No data
1176457814_1176457823 -3 Left 1176457814 21:6928760-6928782 CCAGGCAGCCCACTGCCTTGCTC No data
Right 1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG No data
1176457807_1176457823 18 Left 1176457807 21:6928739-6928761 CCCTACCCAGCTGCTCCAAACCC No data
Right 1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG No data
1176457813_1176457823 -2 Left 1176457813 21:6928759-6928781 CCCAGGCAGCCCACTGCCTTGCT No data
Right 1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG No data
1176457804_1176457823 30 Left 1176457804 21:6928727-6928749 CCATTGCCCTCGCCCTACCCAGC No data
Right 1176457823 21:6928780-6928802 CTCTGGGGACGGAGAGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176457823 Original CRISPR CTCTGGGGACGGAGAGCAGA GGG Intergenic
No off target data available for this crispr