ID: 1176459704

View in Genome Browser
Species Human (GRCh38)
Location 21:6997442-6997464
Sequence GGTCCTCGCTGCTGGCCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176459697_1176459704 2 Left 1176459697 21:6997417-6997439 CCGGATGGGCCGGACGGGACGTG No data
Right 1176459704 21:6997442-6997464 GGTCCTCGCTGCTGGCCCAGCGG No data
1176459702_1176459704 -7 Left 1176459702 21:6997426-6997448 CCGGACGGGACGTGGGGGTCCTC No data
Right 1176459704 21:6997442-6997464 GGTCCTCGCTGCTGGCCCAGCGG No data
1176459693_1176459704 14 Left 1176459693 21:6997405-6997427 CCAGGGACAGGACCGGATGGGCC No data
Right 1176459704 21:6997442-6997464 GGTCCTCGCTGCTGGCCCAGCGG No data
1176459692_1176459704 15 Left 1176459692 21:6997404-6997426 CCCAGGGACAGGACCGGATGGGC No data
Right 1176459704 21:6997442-6997464 GGTCCTCGCTGCTGGCCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176459704 Original CRISPR GGTCCTCGCTGCTGGCCCAG CGG Intergenic