ID: 1176459704 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:6997442-6997464 |
| Sequence | GGTCCTCGCTGCTGGCCCAG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1176459697_1176459704 | 2 | Left | 1176459697 | 21:6997417-6997439 | CCGGATGGGCCGGACGGGACGTG | No data | ||
| Right | 1176459704 | 21:6997442-6997464 | GGTCCTCGCTGCTGGCCCAGCGG | No data | ||||
| 1176459702_1176459704 | -7 | Left | 1176459702 | 21:6997426-6997448 | CCGGACGGGACGTGGGGGTCCTC | No data | ||
| Right | 1176459704 | 21:6997442-6997464 | GGTCCTCGCTGCTGGCCCAGCGG | No data | ||||
| 1176459693_1176459704 | 14 | Left | 1176459693 | 21:6997405-6997427 | CCAGGGACAGGACCGGATGGGCC | No data | ||
| Right | 1176459704 | 21:6997442-6997464 | GGTCCTCGCTGCTGGCCCAGCGG | No data | ||||
| 1176459692_1176459704 | 15 | Left | 1176459692 | 21:6997404-6997426 | CCCAGGGACAGGACCGGATGGGC | No data | ||
| Right | 1176459704 | 21:6997442-6997464 | GGTCCTCGCTGCTGGCCCAGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1176459704 | Original CRISPR | GGTCCTCGCTGCTGGCCCAG CGG | Intergenic | ||