ID: 1176460560

View in Genome Browser
Species Human (GRCh38)
Location 21:7004375-7004397
Sequence TACAGGTGACTGTGCCGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176460560_1176460566 26 Left 1176460560 21:7004375-7004397 CCACCTCGGCACAGTCACCTGTA No data
Right 1176460566 21:7004424-7004446 AAGTAGACACAAATCCCCATGGG No data
1176460560_1176460564 0 Left 1176460560 21:7004375-7004397 CCACCTCGGCACAGTCACCTGTA No data
Right 1176460564 21:7004398-7004420 GTGTACTGAGATGAGCAAGGAGG No data
1176460560_1176460565 25 Left 1176460560 21:7004375-7004397 CCACCTCGGCACAGTCACCTGTA No data
Right 1176460565 21:7004423-7004445 CAAGTAGACACAAATCCCCATGG No data
1176460560_1176460563 -3 Left 1176460560 21:7004375-7004397 CCACCTCGGCACAGTCACCTGTA No data
Right 1176460563 21:7004395-7004417 GTAGTGTACTGAGATGAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176460560 Original CRISPR TACAGGTGACTGTGCCGAGG TGG (reversed) Intergenic
No off target data available for this crispr