ID: 1176460561

View in Genome Browser
Species Human (GRCh38)
Location 21:7004378-7004400
Sequence CACTACAGGTGACTGTGCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176460561_1176460566 23 Left 1176460561 21:7004378-7004400 CCTCGGCACAGTCACCTGTAGTG No data
Right 1176460566 21:7004424-7004446 AAGTAGACACAAATCCCCATGGG No data
1176460561_1176460564 -3 Left 1176460561 21:7004378-7004400 CCTCGGCACAGTCACCTGTAGTG No data
Right 1176460564 21:7004398-7004420 GTGTACTGAGATGAGCAAGGAGG No data
1176460561_1176460567 28 Left 1176460561 21:7004378-7004400 CCTCGGCACAGTCACCTGTAGTG No data
Right 1176460567 21:7004429-7004451 GACACAAATCCCCATGGGCTTGG No data
1176460561_1176460563 -6 Left 1176460561 21:7004378-7004400 CCTCGGCACAGTCACCTGTAGTG No data
Right 1176460563 21:7004395-7004417 GTAGTGTACTGAGATGAGCAAGG No data
1176460561_1176460565 22 Left 1176460561 21:7004378-7004400 CCTCGGCACAGTCACCTGTAGTG No data
Right 1176460565 21:7004423-7004445 CAAGTAGACACAAATCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176460561 Original CRISPR CACTACAGGTGACTGTGCCG AGG (reversed) Intergenic
No off target data available for this crispr