ID: 1176460562

View in Genome Browser
Species Human (GRCh38)
Location 21:7004392-7004414
Sequence TGCTCATCTCAGTACACTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176460562_1176460565 8 Left 1176460562 21:7004392-7004414 CCTGTAGTGTACTGAGATGAGCA No data
Right 1176460565 21:7004423-7004445 CAAGTAGACACAAATCCCCATGG No data
1176460562_1176460566 9 Left 1176460562 21:7004392-7004414 CCTGTAGTGTACTGAGATGAGCA No data
Right 1176460566 21:7004424-7004446 AAGTAGACACAAATCCCCATGGG No data
1176460562_1176460567 14 Left 1176460562 21:7004392-7004414 CCTGTAGTGTACTGAGATGAGCA No data
Right 1176460567 21:7004429-7004451 GACACAAATCCCCATGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176460562 Original CRISPR TGCTCATCTCAGTACACTAC AGG (reversed) Intergenic