ID: 1176460562 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:7004392-7004414 |
Sequence | TGCTCATCTCAGTACACTAC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1176460562_1176460565 | 8 | Left | 1176460562 | 21:7004392-7004414 | CCTGTAGTGTACTGAGATGAGCA | No data | ||
Right | 1176460565 | 21:7004423-7004445 | CAAGTAGACACAAATCCCCATGG | No data | ||||
1176460562_1176460566 | 9 | Left | 1176460562 | 21:7004392-7004414 | CCTGTAGTGTACTGAGATGAGCA | No data | ||
Right | 1176460566 | 21:7004424-7004446 | AAGTAGACACAAATCCCCATGGG | No data | ||||
1176460562_1176460567 | 14 | Left | 1176460562 | 21:7004392-7004414 | CCTGTAGTGTACTGAGATGAGCA | No data | ||
Right | 1176460567 | 21:7004429-7004451 | GACACAAATCCCCATGGGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1176460562 | Original CRISPR | TGCTCATCTCAGTACACTAC AGG (reversed) | Intergenic | ||