ID: 1176460566

View in Genome Browser
Species Human (GRCh38)
Location 21:7004424-7004446
Sequence AAGTAGACACAAATCCCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176460562_1176460566 9 Left 1176460562 21:7004392-7004414 CCTGTAGTGTACTGAGATGAGCA No data
Right 1176460566 21:7004424-7004446 AAGTAGACACAAATCCCCATGGG No data
1176460559_1176460566 27 Left 1176460559 21:7004374-7004396 CCCACCTCGGCACAGTCACCTGT No data
Right 1176460566 21:7004424-7004446 AAGTAGACACAAATCCCCATGGG No data
1176460561_1176460566 23 Left 1176460561 21:7004378-7004400 CCTCGGCACAGTCACCTGTAGTG No data
Right 1176460566 21:7004424-7004446 AAGTAGACACAAATCCCCATGGG No data
1176460560_1176460566 26 Left 1176460560 21:7004375-7004397 CCACCTCGGCACAGTCACCTGTA No data
Right 1176460566 21:7004424-7004446 AAGTAGACACAAATCCCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176460566 Original CRISPR AAGTAGACACAAATCCCCAT GGG Intergenic
No off target data available for this crispr