ID: 1176460567

View in Genome Browser
Species Human (GRCh38)
Location 21:7004429-7004451
Sequence GACACAAATCCCCATGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176460561_1176460567 28 Left 1176460561 21:7004378-7004400 CCTCGGCACAGTCACCTGTAGTG No data
Right 1176460567 21:7004429-7004451 GACACAAATCCCCATGGGCTTGG No data
1176460562_1176460567 14 Left 1176460562 21:7004392-7004414 CCTGTAGTGTACTGAGATGAGCA No data
Right 1176460567 21:7004429-7004451 GACACAAATCCCCATGGGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176460567 Original CRISPR GACACAAATCCCCATGGGCT TGG Intergenic
No off target data available for this crispr