ID: 1176460982

View in Genome Browser
Species Human (GRCh38)
Location 21:7006836-7006858
Sequence CAGAGGAAAAAGGAGCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176460982_1176460991 14 Left 1176460982 21:7006836-7006858 CCTCCATGCTCCTTTTTCCTCTG No data
Right 1176460991 21:7006873-7006895 CAATGCCTCCCGCAACTCTCAGG No data
1176460982_1176460995 24 Left 1176460982 21:7006836-7006858 CCTCCATGCTCCTTTTTCCTCTG No data
Right 1176460995 21:7006883-7006905 CGCAACTCTCAGGTCACCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176460982 Original CRISPR CAGAGGAAAAAGGAGCATGG AGG (reversed) Intergenic
No off target data available for this crispr