ID: 1176460993

View in Genome Browser
Species Human (GRCh38)
Location 21:7006881-7006903
Sequence AATGGTGACCTGAGAGTTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176460993_1176461000 30 Left 1176460993 21:7006881-7006903 CCCGCAACTCTCAGGTCACCATT No data
Right 1176461000 21:7006934-7006956 GCAGTCAACCCTGCTGAAGGTGG No data
1176460993_1176460996 -7 Left 1176460993 21:7006881-7006903 CCCGCAACTCTCAGGTCACCATT No data
Right 1176460996 21:7006897-7006919 CACCATTGGAGAAGATGCTCAGG No data
1176460993_1176460998 3 Left 1176460993 21:7006881-7006903 CCCGCAACTCTCAGGTCACCATT No data
Right 1176460998 21:7006907-7006929 GAAGATGCTCAGGAAGAACAAGG No data
1176460993_1176460999 27 Left 1176460993 21:7006881-7006903 CCCGCAACTCTCAGGTCACCATT No data
Right 1176460999 21:7006931-7006953 GCTGCAGTCAACCCTGCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176460993 Original CRISPR AATGGTGACCTGAGAGTTGC GGG (reversed) Intergenic
No off target data available for this crispr