ID: 1176464463

View in Genome Browser
Species Human (GRCh38)
Location 21:7042232-7042254
Sequence AAGTAGACACAAATCCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176464463_1176464469 26 Left 1176464463 21:7042232-7042254 CCCATGGGGATTTGTGTCTACTT No data
Right 1176464469 21:7042281-7042303 TACAGGTGACTGTGCCGAGGTGG No data
1176464463_1176464470 27 Left 1176464463 21:7042232-7042254 CCCATGGGGATTTGTGTCTACTT No data
Right 1176464470 21:7042282-7042304 ACAGGTGACTGTGCCGAGGTGGG No data
1176464463_1176464468 23 Left 1176464463 21:7042232-7042254 CCCATGGGGATTTGTGTCTACTT No data
Right 1176464468 21:7042278-7042300 CACTACAGGTGACTGTGCCGAGG No data
1176464463_1176464467 9 Left 1176464463 21:7042232-7042254 CCCATGGGGATTTGTGTCTACTT No data
Right 1176464467 21:7042264-7042286 TGCTCATCTCAGTACACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176464463 Original CRISPR AAGTAGACACAAATCCCCAT GGG (reversed) Intergenic
No off target data available for this crispr