ID: 1176465327 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:7049186-7049208 |
| Sequence | GGTCCTCGATGCTGGCCCAG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1176465327_1176465338 | 14 | Left | 1176465327 | 21:7049186-7049208 | CCGCTGGGCCAGCATCGAGGACC | No data | ||
| Right | 1176465338 | 21:7049223-7049245 | GGCCCATCCGGTGCTGTCCCTGG | No data | ||||
| 1176465327_1176465335 | 2 | Left | 1176465327 | 21:7049186-7049208 | CCGCTGGGCCAGCATCGAGGACC | No data | ||
| Right | 1176465335 | 21:7049211-7049233 | CACATCCGGCCTGGCCCATCCGG | No data | ||||
| 1176465327_1176465339 | 15 | Left | 1176465327 | 21:7049186-7049208 | CCGCTGGGCCAGCATCGAGGACC | No data | ||
| Right | 1176465339 | 21:7049224-7049246 | GCCCATCCGGTGCTGTCCCTGGG | No data | ||||
| 1176465327_1176465330 | -7 | Left | 1176465327 | 21:7049186-7049208 | CCGCTGGGCCAGCATCGAGGACC | No data | ||
| Right | 1176465330 | 21:7049202-7049224 | GAGGACCCCCACATCCGGCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1176465327 | Original CRISPR | GGTCCTCGATGCTGGCCCAG CGG (reversed) | Intronic | ||