ID: 1176465327

View in Genome Browser
Species Human (GRCh38)
Location 21:7049186-7049208
Sequence GGTCCTCGATGCTGGCCCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176465327_1176465338 14 Left 1176465327 21:7049186-7049208 CCGCTGGGCCAGCATCGAGGACC No data
Right 1176465338 21:7049223-7049245 GGCCCATCCGGTGCTGTCCCTGG No data
1176465327_1176465335 2 Left 1176465327 21:7049186-7049208 CCGCTGGGCCAGCATCGAGGACC No data
Right 1176465335 21:7049211-7049233 CACATCCGGCCTGGCCCATCCGG No data
1176465327_1176465339 15 Left 1176465327 21:7049186-7049208 CCGCTGGGCCAGCATCGAGGACC No data
Right 1176465339 21:7049224-7049246 GCCCATCCGGTGCTGTCCCTGGG No data
1176465327_1176465330 -7 Left 1176465327 21:7049186-7049208 CCGCTGGGCCAGCATCGAGGACC No data
Right 1176465330 21:7049202-7049224 GAGGACCCCCACATCCGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176465327 Original CRISPR GGTCCTCGATGCTGGCCCAG CGG (reversed) Intronic