ID: 1176468343

View in Genome Browser
Species Human (GRCh38)
Location 21:7080210-7080232
Sequence GAGTAGGCTTGGACACCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 6, 1: 1, 2: 2, 3: 23, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176468339_1176468343 -6 Left 1176468339 21:7080193-7080215 CCTTCCATGGTTGGTGTGAGTAG 0: 5
1: 1
2: 5
3: 12
4: 152
Right 1176468343 21:7080210-7080232 GAGTAGGCTTGGACACCTGCAGG 0: 6
1: 1
2: 2
3: 23
4: 116
1176468341_1176468343 -10 Left 1176468341 21:7080197-7080219 CCATGGTTGGTGTGAGTAGGCTT 0: 5
1: 1
2: 0
3: 9
4: 105
Right 1176468343 21:7080210-7080232 GAGTAGGCTTGGACACCTGCAGG 0: 6
1: 1
2: 2
3: 23
4: 116
1176468335_1176468343 29 Left 1176468335 21:7080158-7080180 CCAAGGCTCTATATCTTCTGGCA 0: 6
1: 0
2: 0
3: 10
4: 142
Right 1176468343 21:7080210-7080232 GAGTAGGCTTGGACACCTGCAGG 0: 6
1: 1
2: 2
3: 23
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176468343 Original CRISPR GAGTAGGCTTGGACACCTGC AGG Intronic
900897040 1:5490538-5490560 GAAAAGGCTTGGACCCCTCCAGG - Intergenic
901184155 1:7361474-7361496 GAGAAGCCTGGGACACCTCCTGG + Intronic
901597889 1:10399389-10399411 GAGTCTGCAGGGACACCTGCGGG + Intronic
901658223 1:10782746-10782768 GAGTGGGCCTGGTCACCTGGGGG + Intronic
901933118 1:12609621-12609643 GAGGAGGCATGGAAACCTGGCGG + Intronic
902664473 1:17927822-17927844 GCAGAGGCCTGGACACCTGCAGG + Intergenic
904304188 1:29576774-29576796 GAATAGGATATGACACCTGCAGG - Intergenic
906630140 1:47360188-47360210 GACCAGGCTTAGACACCTTCAGG - Intronic
914414718 1:147469131-147469153 GAATGGGATTGGAGACCTGCTGG + Intergenic
915007826 1:152656349-152656371 GAGGAGGCTGGCACAGCTGCTGG - Intergenic
921066991 1:211630469-211630491 GAGGCGGCTTGGTCACATGCTGG - Intergenic
924787008 1:247208208-247208230 GTGCAGGCTGGGACACCTGCAGG + Intergenic
1064766234 10:18675608-18675630 GAGTAGTCTTGGAAACCATCAGG + Exonic
1066710421 10:38227555-38227577 GAGCAGGCTGGGACAGCTGCAGG - Intergenic
1066975395 10:42363609-42363631 GAGCGGGCTGGGACACCTGCAGG + Intergenic
1067231276 10:44412688-44412710 GAGTAGGCCTGGACTCAGGCAGG + Intergenic
1067451408 10:46384279-46384301 GCCTAGGCTGTGACACCTGCAGG - Intronic
1067585834 10:47475477-47475499 GCCTAGGCTGTGACACCTGCAGG + Exonic
1067669702 10:48307259-48307281 GGGCAGGCTTGGGGACCTGCCGG - Intronic
1071146983 10:82587024-82587046 AAATAGGCATGGACACCTGAGGG - Intronic
1074738116 10:116456896-116456918 GACTAGGCTGGGGCACCAGCGGG - Intronic
1076636549 10:131885098-131885120 GGGGAGGGATGGACACCTGCTGG + Intergenic
1088736528 11:112732282-112732304 GGCTGGGCTTGCACACCTGCTGG + Intergenic
1098130483 12:67345026-67345048 GAGAACACTTGGACACATGCAGG - Intergenic
1099073374 12:78074871-78074893 GAGTTGGGTTGGACAACTGGAGG - Intronic
1099960264 12:89390419-89390441 CAGTTGGCTTGGACCTCTGCGGG + Intergenic
1102301582 12:111775340-111775362 GAGGAGGCTTGGCCAGCTGAGGG - Intronic
1102338085 12:112099679-112099701 CAGCAGGCCTGGACACATGCAGG + Intronic
1103509464 12:121464686-121464708 AAGTAGACTTGCCCACCTGCTGG - Intronic
1108267983 13:48731207-48731229 CATCAGGCTTGGGCACCTGCTGG + Intergenic
1114504177 14:23196338-23196360 GAGTGGGCTTGGAAGCCAGCTGG - Intronic
1117450686 14:55846535-55846557 GTGTATGATTGGACACCAGCTGG + Intergenic
1121907404 14:97759014-97759036 GATCAGGCTTGGTCACCTCCAGG + Intronic
1125569663 15:40706572-40706594 GAGTAGGCATGTGCACCTACAGG - Intronic
1127878567 15:63134502-63134524 CAGGAGGCTGGGGCACCTGCAGG - Intronic
1130917936 15:88320684-88320706 GTGTAGGCATGGACACTGGCAGG - Intergenic
1131064181 15:89422821-89422843 CAATAGGCTTGCACACCTGTGGG - Intergenic
1134238003 16:12482971-12482993 GTGAAGGCATGGACACCTCCAGG - Intronic
1136673289 16:31876879-31876901 GAGCAGGCTGGGAAACCTGCAGG - Intronic
1139162298 16:64525425-64525447 CAGTATTCTTGGATACCTGCAGG - Intergenic
1141884404 16:86881866-86881888 GAGCAGCCTTGGACTCTTGCCGG + Intergenic
1142433589 16:90043568-90043590 GAGTAGGCCTGGACACAGGCTGG - Exonic
1142899375 17:3002831-3002853 AAGTTGGATTAGACACCTGCAGG + Intronic
1149685899 17:58534541-58534563 GAGTTGGCCAGGCCACCTGCTGG - Intronic
1152813993 17:82396965-82396987 GAGTGGGCTTGGCCAGCCGCTGG + Intronic
1153618760 18:6956708-6956730 AAGTCGACCTGGACACCTGCTGG - Exonic
1156540119 18:37901395-37901417 CTGTAGGCCTGGACACTTGCTGG - Intergenic
1158922926 18:62214460-62214482 GAGTAGCCTGGGAGAGCTGCAGG - Intronic
1161237205 19:3204078-3204100 GAGGCGGCTTGGACACGTGCAGG - Exonic
1162674779 19:12290770-12290792 GATTAGGCTGGGACACCTGCAGG + Intronic
1163870539 19:19817610-19817632 GAGCAGGCTGAGACAGCTGCAGG + Intronic
1163879194 19:19902604-19902626 GAATAGGCTGGGACATCTGCAGG - Intronic
1163908669 19:20169456-20169478 GAGCAGGCTGGGACATCTGCAGG - Intronic
1163933678 19:20422806-20422828 GAGCAGGCTGGGACATCTGCAGG + Intergenic
1163939844 19:20481477-20481499 GCGCAGGCTGGGACATCTGCAGG - Intergenic
1163948555 19:20563270-20563292 GAGCAGGCTGGGACATGTGCAGG + Intronic
1163983836 19:20926635-20926657 GAGCAGGCTGGGACATCTGCAGG - Intronic
1163993789 19:21024155-21024177 GAGCAGGCTAGGACATCTGCAGG - Intronic
1164005582 19:21145533-21145555 GAGCAGACTGGGACATCTGCAGG - Intronic
1164027174 19:21363396-21363418 GAGCAGGCTAGAACATCTGCAGG - Intronic
1164030642 19:21400631-21400653 GAGCAGGCTGGAACATCTGCAGG - Intronic
1164042914 19:21509586-21509608 GAGCAGGCAGGGACACCTGCAGG - Intronic
1164048673 19:21565036-21565058 GAGCAGGCTGGGACTTCTGCAGG + Intergenic
1164053273 19:21601008-21601030 GAGCAGGCTAGGGCATCTGCAGG + Intergenic
1164070540 19:21764106-21764128 GAGAAGGCTGGGACATCTGCAGG + Intronic
1164095532 19:22006609-22006631 AAGCAGGCTGGGACATCTGCAGG + Intronic
1164115001 19:22211294-22211316 AAGCAGGCTGGGACATCTGCAGG + Intergenic
1164198809 19:22999459-22999481 AAGCAGGCTGGGACATCTGCAGG + Intronic
1164225936 19:23245991-23246013 GAGCAGGCTAGGAAATCTGCAGG + Intronic
1164241305 19:23391771-23391793 GAGCAAGCTGGGACATCTGCAGG + Intronic
1164243549 19:23410847-23410869 GAGCAGGCCAGGACATCTGCAGG + Intergenic
1164306636 19:24009700-24009722 GAGCAGGCTGGGACACCTGCAGG + Intergenic
1164309618 19:24034274-24034296 GAGCAGGCTGGGACATCTGCAGG - Intronic
1164734986 19:30534855-30534877 GAGGAGGCTGGGAGATCTGCCGG + Exonic
1164769167 19:30795113-30795135 GAGTAGCCCTGACCACCTGCAGG - Intergenic
1167593186 19:50415248-50415270 GAGTCGGCTTGGGCAGCTGTGGG + Intronic
925201952 2:1974610-1974632 GAGTAAGCTTGGATCCCTGCTGG + Intronic
925407145 2:3613188-3613210 GAAGGGGCTTGGCCACCTGCAGG + Intronic
938561951 2:132480593-132480615 TAGTAGGATTTGGCACCTGCAGG + Intronic
939895576 2:147787098-147787120 GATTAGGTTTGGACACCTGGAGG - Intergenic
942402376 2:175616828-175616850 GAGTATGGTTGGACAGATGCTGG - Intergenic
943353878 2:186826602-186826624 GAGAAGACATGGACACCTGGTGG + Intergenic
945679756 2:212899561-212899583 GACTAAGCTTGTTCACCTGCTGG + Intergenic
946713311 2:222527953-222527975 CAGTAGACTTGGACACCTGAGGG - Intronic
949003082 2:241628477-241628499 GATTAGGCTTGAGCACCTGGAGG - Intronic
1173528584 20:43751254-43751276 GAGCTGTCTTGGCCACCTGCAGG + Intergenic
1175251811 20:57614503-57614525 GACTAGTCTTGGACCCCTACCGG - Intronic
1175511132 20:59526896-59526918 GAGTAGGCTGGGACATGTTCAGG + Intergenic
1176334681 21:5584984-5585006 GAGTAGGCTTGGACACCTGCAGG + Intergenic
1176393076 21:6235964-6235986 GAGTAGGCTTGGACACCTGCAGG - Intergenic
1176468343 21:7080210-7080232 GAGTAGGCTTGGACACCTGCAGG + Intronic
1176491904 21:7461988-7462010 GAGTAGGCTTGGACACCTGCAGG + Intergenic
1176508738 21:7676395-7676417 GAGTAGGCTTGGACACCTGCAGG - Intergenic
1181676875 22:24460528-24460550 CAGAAAGCTTGGACACCAGCAGG - Intergenic
1181860496 22:25814129-25814151 GAGGAGATTAGGACACCTGCGGG + Intronic
1183058652 22:35322104-35322126 GAGGAGGCTGGGAGTCCTGCTGG - Intronic
1183961407 22:41413836-41413858 GGGGAGGGTAGGACACCTGCCGG - Intergenic
1184764299 22:46563698-46563720 GAGGATGCTGGCACACCTGCTGG - Intergenic
1184919621 22:47596527-47596549 GTGTGGGCTTAGACAACTGCAGG + Intergenic
949439769 3:4067745-4067767 GAGTAGGGCTGGGCACCTGCAGG - Intronic
950427095 3:12930386-12930408 GGGTAGGCTGGGAAACCTGGGGG - Intronic
953534846 3:43769757-43769779 GAGGAGGCTTGCAGACCTGCAGG + Intergenic
956745944 3:72311113-72311135 GTGGGGGCCTGGACACCTGCTGG - Intergenic
961492073 3:127263282-127263304 GGGCAGGCATGGCCACCTGCTGG - Intergenic
962499153 3:135971764-135971786 GTGTATGCTTGGACAGCTGTGGG + Intronic
969463380 4:7340645-7340667 GAGCACGCTTGCACACCTGTGGG + Intronic
969464677 4:7349314-7349336 GAGAATGCTGAGACACCTGCAGG - Intronic
972630902 4:40841081-40841103 GAGTGGGCGGTGACACCTGCAGG - Intronic
976609333 4:87013583-87013605 GTGAGGGCTTGGAGACCTGCAGG + Intronic
981198080 4:141943544-141943566 GACTAGGCATGCCCACCTGCAGG - Intergenic
985569860 5:639011-639033 GGGTGCGCTTGGGCACCTGCTGG + Intronic
985684953 5:1277144-1277166 GAGGCGGCTTCGACACCTTCAGG + Intronic
986794591 5:11196990-11197012 GAGGGGGCCTGGAAACCTGCAGG - Intronic
999441171 5:151601959-151601981 GAGTGGGCTTGGGCTCCTGGGGG - Intergenic
1000848221 5:166307638-166307660 AAAAAGGCTTGGAAACCTGCTGG - Intergenic
1002178182 5:177414394-177414416 GAATAGGCTTGGAAATGTGCAGG - Intronic
1002605943 5:180382801-180382823 CAGCAGGCTTGGCCATCTGCAGG - Intergenic
1006806179 6:36791114-36791136 GAGGAGGCTGGGACAGATGCAGG - Intronic
1017074049 6:150600934-150600956 CAGTAGCCTCGGCCACCTGCGGG - Intronic
1017972874 6:159328259-159328281 GAGAATCCTTGGACACATGCTGG - Intergenic
1019286720 7:226963-226985 GTGTGGGCTTGGACGGCTGCAGG - Intronic
1021824151 7:24531401-24531423 GAGTAGACTTGGGCATCTGGGGG - Intergenic
1022328617 7:29356201-29356223 GACAAGTCTTGGACACGTGCAGG - Intronic
1022842914 7:34181875-34181897 GAGGGGGCATGGGCACCTGCAGG + Intergenic
1024082206 7:45864955-45864977 GAGTAGTCTTGCTCAGCTGCAGG - Intergenic
1025265621 7:57454515-57454537 GAGCAGGCTGGGACATCTGCAGG - Intronic
1025719036 7:63992558-63992580 GAGCAGGTTGGGACATCTGCAGG - Intergenic
1025747183 7:64253398-64253420 GAGCAGGCTGGGACATCTGCTGG - Intronic
1025767312 7:64467717-64467739 GCACAGGCTGGGACACCTGCAGG - Intergenic
1025778830 7:64581571-64581593 GAGCAAGCTGGGACATCTGCAGG - Intergenic
1025798548 7:64762328-64762350 GAGTAGGCTGGGACACCTGCAGG - Intergenic
1025815426 7:64906635-64906657 GAGCAGGCTGGGACATCTGCAGG - Intronic
1025824938 7:65003135-65003157 GAGCAGGCTGGGACATCTGCAGG + Intronic
1025865526 7:65377334-65377356 GAGCAGGCTGGGACATCTTCAGG - Intronic
1026270037 7:68828655-68828677 CAGTAGCCTTGGACAGCAGCAGG + Intergenic
1032731369 7:134646616-134646638 GAGTTGGCTTCGACGCCAGCGGG - Intergenic
1033240615 7:139676335-139676357 GTGTAGGCTCAGACACCCGCAGG - Intronic
1036439294 8:8766091-8766113 AAGTAGGCATGGGCATCTGCTGG - Intergenic
1037754048 8:21700153-21700175 GGTCAGTCTTGGACACCTGCAGG - Intronic
1038444993 8:27597312-27597334 GGGTAGTCATGGCCACCTGCTGG + Exonic
1041933081 8:63308583-63308605 GAGCAGGCTTGGGAACCTGTTGG + Intergenic
1044661592 8:94596608-94596630 GGCTAGGCTTGGACACATGGAGG - Intergenic
1047813019 8:128430668-128430690 GAGTAAGCTTGGCCATCTGGAGG + Intergenic
1049088158 8:140493864-140493886 GAGTAGGCTTAGACATCTTTCGG - Intergenic
1052207496 9:25860751-25860773 GAGTAGGTTTTCACACTTGCTGG + Intergenic
1062599348 9:137312968-137312990 GCATAGGCTGGCACACCTGCAGG - Intronic
1203426955 Un_GL000195v1:49936-49958 GAGTAGGCTTGGACACCTGCAGG - Intergenic
1192757685 X:74063854-74063876 GAGAAGGCTTGGCCACCACCTGG - Intergenic