ID: 1176468344

View in Genome Browser
Species Human (GRCh38)
Location 21:7080211-7080233
Sequence AGTAGGCTTGGACACCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 6, 1: 1, 2: 2, 3: 18, 4: 140}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176468335_1176468344 30 Left 1176468335 21:7080158-7080180 CCAAGGCTCTATATCTTCTGGCA 0: 6
1: 0
2: 0
3: 10
4: 142
Right 1176468344 21:7080211-7080233 AGTAGGCTTGGACACCTGCAGGG 0: 6
1: 1
2: 2
3: 18
4: 140
1176468339_1176468344 -5 Left 1176468339 21:7080193-7080215 CCTTCCATGGTTGGTGTGAGTAG 0: 5
1: 1
2: 5
3: 12
4: 152
Right 1176468344 21:7080211-7080233 AGTAGGCTTGGACACCTGCAGGG 0: 6
1: 1
2: 2
3: 18
4: 140
1176468341_1176468344 -9 Left 1176468341 21:7080197-7080219 CCATGGTTGGTGTGAGTAGGCTT 0: 5
1: 1
2: 0
3: 9
4: 105
Right 1176468344 21:7080211-7080233 AGTAGGCTTGGACACCTGCAGGG 0: 6
1: 1
2: 2
3: 18
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176468344 Original CRISPR AGTAGGCTTGGACACCTGCA GGG Intronic
900999889 1:6143662-6143684 TGTAGGCTAGGACAGCTGGAAGG - Intronic
902658050 1:17883048-17883070 AGTAGGCTTGTGCACATGGAGGG + Intergenic
904328965 1:29745518-29745540 AGTAAGCTGGGAGACATGCAGGG - Intergenic
904909449 1:33922856-33922878 AGGAGGCTTGGAGACCAGGAGGG - Intronic
906544091 1:46609339-46609361 AATAGGCTTGGGAACCAGCATGG + Exonic
906630139 1:47360187-47360209 ACCAGGCTTAGACACCTTCAGGG - Intronic
912693427 1:111821755-111821777 AGCAGGCATGGCCTCCTGCAGGG + Intronic
916880047 1:169011927-169011949 ATTAGCCTTCGTCACCTGCAAGG + Intergenic
924787009 1:247208209-247208231 TGCAGGCTGGGACACCTGCAGGG + Intergenic
1063203834 10:3811750-3811772 AGAAGGCTTGCTAACCTGCAGGG + Intergenic
1066710420 10:38227554-38227576 AGCAGGCTGGGACAGCTGCAGGG - Intergenic
1067583673 10:47462241-47462263 AGGGAACTTGGACACCTGCATGG + Intronic
1067633676 10:47987589-47987611 AGGGAACTTGGACACCTGCATGG + Intergenic
1068072105 10:52207799-52207821 AGTAAGCTGGGAACCCTGCATGG - Intronic
1071146982 10:82587023-82587045 AATAGGCATGGACACCTGAGGGG - Intronic
1071611907 10:87039226-87039248 AGTAAGCTGGGAGGCCTGCATGG - Intergenic
1072048181 10:91678122-91678144 AGTAGGCCTGGCCTCCTACAAGG - Intergenic
1074919290 10:117991239-117991261 AGTGAGCTTGGACAGGTGCAGGG - Intergenic
1076704137 10:132292034-132292056 AGGAGCCTTGGGCCCCTGCAGGG - Intronic
1077140832 11:1024154-1024176 ATCAGGCTTTGCCACCTGCAGGG + Intronic
1082880287 11:58030290-58030312 AGTAGGCTGGGACACCATGAAGG - Intronic
1083202526 11:61129245-61129267 CTCAGCCTTGGACACCTGCAAGG + Intergenic
1083772605 11:64876939-64876961 AGTAGGCCTGGCCACCAGCTTGG + Intronic
1083843298 11:65316525-65316547 AGTAGGCGTGGCCCACTGCATGG + Intronic
1092010526 12:5106931-5106953 AGCAGGCATGAACACCTGAATGG + Intergenic
1092940812 12:13405345-13405367 AGGAAGCTTGGAAACTTGCAGGG + Intergenic
1095910794 12:47424566-47424588 AGCATGCTTGGACACTAGCAGGG - Intergenic
1096263421 12:50106554-50106576 AGGAGGCTGGGACACCCCCAGGG + Intronic
1096807501 12:54149402-54149424 CCTAGGCTTGGACCCCTGGAAGG - Intergenic
1098130482 12:67345025-67345047 AGAACACTTGGACACATGCAGGG - Intergenic
1099842417 12:87982483-87982505 AGTAGGTTTGGAAATCTACAGGG - Intronic
1099960265 12:89390420-89390442 AGTTGGCTTGGACCTCTGCGGGG + Intergenic
1104058134 12:125245829-125245851 ACAAGCCTGGGACACCTGCAAGG - Intronic
1106480896 13:30136085-30136107 AGGAGGCCTGGGCACCTGCCTGG - Intergenic
1106510519 13:30408704-30408726 AGTAGGTTTGGAGGCCGGCAAGG - Intergenic
1108267984 13:48731208-48731230 ATCAGGCTTGGGCACCTGCTGGG + Intergenic
1110158822 13:72351430-72351452 AGTAGGCTTAGAAACTAGCAGGG - Intergenic
1118814230 14:69298577-69298599 ACTTGGCTTGGGCAACTGCAGGG - Intronic
1121988380 14:98529992-98530014 TGTAGGGTTGGAGACCTACAGGG - Intergenic
1123668375 15:22628509-22628531 AGTCGGCTTGGGCAAGTGCATGG - Intergenic
1123755496 15:23394717-23394739 CCCAGGCTTAGACACCTGCAAGG - Intergenic
1125569662 15:40706571-40706593 AGTAGGCATGTGCACCTACAGGG - Intronic
1126206699 15:46053531-46053553 AGAAGGCTGGGAACCCTGCATGG - Intergenic
1127878566 15:63134501-63134523 AGGAGGCTGGGGCACCTGCAGGG - Intronic
1128725160 15:69982679-69982701 AGCAGGCTTTGACCCCTCCATGG - Intergenic
1133666337 16:7971662-7971684 ACTAGGCTTGGAAACATGAAAGG - Intergenic
1133783945 16:8961133-8961155 AGTAGCCTTGAAAACGTGCATGG + Intronic
1134238002 16:12482970-12482992 TGAAGGCATGGACACCTCCAGGG - Intronic
1134460879 16:14428308-14428330 CCCAGGCTTAGACACCTGCAAGG + Intergenic
1134826704 16:17290577-17290599 GGTAGGCTTTGACACCTCCTTGG - Intronic
1136254722 16:29030332-29030354 GGGTGACTTGGACACCTGCAGGG - Intergenic
1136673288 16:31876878-31876900 AGCAGGCTGGGAAACCTGCAGGG - Intronic
1138729921 16:59183258-59183280 AGGAAGCTGGGAAACCTGCATGG - Intergenic
1139666453 16:68460095-68460117 AGTAGCCTGGCACACCTTCAAGG + Intergenic
1142247899 16:88978188-88978210 AGTCGGCTTTTACTCCTGCACGG - Intergenic
1146170030 17:30625582-30625604 AGAAGGCTTGGACACCGCCCTGG - Intergenic
1152221579 17:79071369-79071391 AGCAGGCTTGGAAACCAGCCTGG - Intergenic
1153068602 18:1078306-1078328 TGCAGGCTTGGACACATCCATGG - Intergenic
1160241112 18:77123944-77123966 AGCAGCCTAGGGCACCTGCACGG + Intronic
1161776011 19:6262524-6262546 AGGAGACTTGGCCACCGGCATGG + Intronic
1162674780 19:12290771-12290793 ATTAGGCTGGGACACCTGCAGGG + Intronic
1163598603 19:18234504-18234526 AGTAGGCATGAACAGCAGCAGGG + Intronic
1163870540 19:19817611-19817633 AGCAGGCTGAGACAGCTGCAGGG + Intronic
1163879193 19:19902603-19902625 AATAGGCTGGGACATCTGCAGGG - Intronic
1163905111 19:20145363-20145385 AGCAGGCTGAGACAGCTGCATGG + Intergenic
1163933679 19:20422807-20422829 AGCAGGCTGGGACATCTGCAGGG + Intergenic
1163939843 19:20481476-20481498 CGCAGGCTGGGACATCTGCAGGG - Intergenic
1163948556 19:20563271-20563293 AGCAGGCTGGGACATGTGCAGGG + Intronic
1163983835 19:20926634-20926656 AGCAGGCTGGGACATCTGCAGGG - Intronic
1163993788 19:21024154-21024176 AGCAGGCTAGGACATCTGCAGGG - Intronic
1164005581 19:21145532-21145554 AGCAGACTGGGACATCTGCAGGG - Intronic
1164030641 19:21400630-21400652 AGCAGGCTGGAACATCTGCAGGG - Intronic
1164042913 19:21509585-21509607 AGCAGGCAGGGACACCTGCAGGG - Intronic
1164048674 19:21565037-21565059 AGCAGGCTGGGACTTCTGCAGGG + Intergenic
1164053274 19:21601009-21601031 AGCAGGCTAGGGCATCTGCAGGG + Intergenic
1164225937 19:23245992-23246014 AGCAGGCTAGGAAATCTGCAGGG + Intronic
1164241306 19:23391772-23391794 AGCAAGCTGGGACATCTGCAGGG + Intronic
1164243550 19:23410848-23410870 AGCAGGCCAGGACATCTGCAGGG + Intergenic
1164306637 19:24009701-24009723 AGCAGGCTGGGACACCTGCAGGG + Intergenic
1164769166 19:30795112-30795134 AGTAGCCCTGACCACCTGCAGGG - Intergenic
1165898534 19:39157179-39157201 AGTAGGCAAGGAGACCTCCATGG - Intronic
1166185824 19:41138166-41138188 AGGAGGCTGAGACACCTTCATGG - Intergenic
1166716811 19:44973622-44973644 AGTGGGCTTGGGCACAGGCAGGG + Intronic
1167558012 19:50207523-50207545 AGTAGGCTGGGAGCCCTGCCTGG - Intronic
925201953 2:1974611-1974633 AGTAAGCTTGGATCCCTGCTGGG + Intronic
925407146 2:3613189-3613211 AAGGGGCTTGGCCACCTGCAGGG + Intronic
927979666 2:27366797-27366819 AGGAGGCTGGGACACCAGCATGG + Exonic
928974638 2:37072468-37072490 AGTAGGCTGGGACAGTTGTAGGG - Intronic
931726148 2:65112724-65112746 AGTAGGCTTTAACAACTGGATGG + Intronic
932323362 2:70838064-70838086 AGGAGACATGGACCCCTGCAAGG - Intergenic
935243050 2:101194571-101194593 AGCAGCCCTGGACACCTCCAGGG - Intronic
940707674 2:157125355-157125377 AGTAGGGATGGGAACCTGCATGG - Intergenic
943456291 2:188111819-188111841 AGTAGGCAGTGACATCTGCATGG + Intergenic
943761101 2:191610281-191610303 AATAGGCTTGGAGAACTGCCTGG - Intergenic
945040196 2:205737663-205737685 ACTAGGCTTGGAAACGTGAAGGG + Intronic
946713310 2:222527952-222527974 AGTAGACTTGGACACCTGAGGGG - Intronic
947138327 2:226997074-226997096 AAGAGGCCTTGACACCTGCATGG + Exonic
947393866 2:229667821-229667843 GGTAGGTTTGGACAACAGCAAGG + Intronic
948151754 2:235749988-235750010 AGTATGCTTAGCCACCTGCGTGG + Intronic
1173032588 20:39376076-39376098 AGTAGGGTTGCACATCTGAAAGG - Intergenic
1173528585 20:43751255-43751277 AGCTGTCTTGGCCACCTGCAGGG + Intergenic
1175274692 20:57760175-57760197 ACTAGGTTGGGCCACCTGCATGG + Intergenic
1175511133 20:59526897-59526919 AGTAGGCTGGGACATGTTCAGGG + Intergenic
1176334682 21:5584985-5585007 AGTAGGCTTGGACACCTGCAGGG + Intergenic
1176393075 21:6235963-6235985 AGTAGGCTTGGACACCTGCAGGG - Intergenic
1176407546 21:6429668-6429690 AAGAAGCGTGGACACCTGCATGG + Intergenic
1176468344 21:7080211-7080233 AGTAGGCTTGGACACCTGCAGGG + Intronic
1176491905 21:7461989-7462011 AGTAGGCTTGGACACCTGCAGGG + Intergenic
1176508737 21:7676394-7676416 AGTAGGCTTGGACACCTGCAGGG - Intergenic
1179942432 21:44648848-44648870 CGTGGGCTTGGACAGTTGCATGG - Intronic
1181676874 22:24460527-24460549 AGAAAGCTTGGACACCAGCAGGG - Intergenic
1184233399 22:43170294-43170316 AGTAGGCTTCAACACAGGCAAGG + Intronic
950534860 3:13572830-13572852 AGGAGCCTTGAACTCCTGCAGGG + Intronic
953534847 3:43769758-43769780 AGGAGGCTTGCAGACCTGCAGGG + Intergenic
956020428 3:64927914-64927936 AGTCAGCTTGGACTCCTGCCTGG + Intergenic
961646601 3:128396028-128396050 GGCAGGCCTTGACACCTGCAGGG - Intronic
964662826 3:159139675-159139697 AGTGGGCTGGGACACCTGCCAGG + Intronic
965486084 3:169280297-169280319 AGTAGGCTTGGATATTTGCCTGG - Intronic
966939439 3:184736158-184736180 AGTAGGCTTCAAAACCTACAAGG - Intergenic
968869257 4:3233229-3233251 AGCAGGGTTGGAGCCCTGCACGG + Exonic
969849793 4:9947247-9947269 TGCAGGCTAGGACAACTGCAAGG - Intronic
972630901 4:40841080-40841102 AGTGGGCGGTGACACCTGCAGGG - Intronic
973981677 4:56313404-56313426 AGTAGGCAAGGGCACCTGCCTGG - Intronic
976223896 4:82780266-82780288 AGTGGTCAAGGACACCTGCATGG - Intronic
979722672 4:123920230-123920252 CGTAGTCTTGGACTACTGCAAGG - Intergenic
980092953 4:128461306-128461328 AGTAGGCTTGCAGCCATGCAAGG + Intergenic
981367477 4:143920021-143920043 AGCAGGTTGGGAGACCTGCAGGG - Intergenic
982110086 4:152045861-152045883 AGCAGGCTTGGACTCCCGCGCGG + Intergenic
983234252 4:165161285-165161307 AGTATGGTTGGACAGCTGGACGG + Intronic
984177924 4:176442221-176442243 AGTAGGCAAAGACAACTGCATGG + Intergenic
985886250 5:2681904-2681926 ACTCGGCTTGGAGAGCTGCAGGG + Intergenic
998808876 5:145945894-145945916 AGTAAGCTCGGTCACCTGCTTGG - Intronic
1001864637 5:175092872-175092894 AGTAGGCCTGCCCCCCTGCAGGG - Intergenic
1004873331 6:19929985-19930007 AGGAGGCTTGGAGACTTGCTTGG + Intergenic
1006806178 6:36791113-36791135 AGGAGGCTGGGACAGATGCAGGG - Intronic
1010037151 6:71339487-71339509 ATTAGACTCAGACACCTGCAAGG + Intergenic
1012980743 6:105828223-105828245 AGAAGACTTGGACACCGGGAAGG + Intergenic
1017622452 6:156313379-156313401 AGTGGTCTTGGAGACCTCCAAGG + Intergenic
1019286719 7:226962-226984 TGTGGGCTTGGACGGCTGCAGGG - Intronic
1022877665 7:34552115-34552137 AGGAAGCTTGGAACCCTGCATGG + Intergenic
1024033099 7:45481616-45481638 AGCAGCCATGGACACCTCCATGG - Intergenic
1025265620 7:57454514-57454536 AGCAGGCTGGGACATCTGCAGGG - Intronic
1025767311 7:64467716-64467738 CACAGGCTGGGACACCTGCAGGG - Intergenic
1025778829 7:64581570-64581592 AGCAAGCTGGGACATCTGCAGGG - Intergenic
1025798547 7:64762327-64762349 AGTAGGCTGGGACACCTGCAGGG - Intergenic
1025815425 7:64906634-64906656 AGCAGGCTGGGACATCTGCAGGG - Intronic
1025824939 7:65003136-65003158 AGCAGGCTGGGACATCTGCAGGG + Intronic
1025865525 7:65377333-65377355 AGCAGGCTGGGACATCTTCAGGG - Intronic
1026474634 7:70724313-70724335 ATTAGTTTTGTACACCTGCAGGG - Intronic
1028307927 7:89290028-89290050 AGTAGGATTGGACACCGGTCAGG + Intronic
1029854449 7:103500828-103500850 TGGATGCTTGGACAACTGCAGGG - Exonic
1030941326 7:115653634-115653656 AGTATCCTTGGACTCCAGCAAGG + Intergenic
1032310386 7:130780608-130780630 AGGAGGCTGGGAGCCCTGCATGG - Intergenic
1035048470 7:155984368-155984390 CGTGGGGTTGGAAACCTGCAGGG - Intergenic
1045506083 8:102779690-102779712 AATAGGGATGGACACCTGCCAGG - Intergenic
1046390046 8:113559057-113559079 AGTGGGCTTGGGAAGCTGCAGGG - Intergenic
1048279842 8:133097051-133097073 TGTAGGCTTGACCACCTACAAGG - Intronic
1050217551 9:3344671-3344693 AGTAGTAATGGGCACCTGCAGGG - Intronic
1052330402 9:27261501-27261523 ATTAGGCAAGGTCACCTGCAAGG + Intergenic
1053471304 9:38347538-38347560 AATTGGCTTGGACAAGTGCATGG - Intergenic
1055497302 9:76868400-76868422 TGTATGTGTGGACACCTGCAAGG - Intronic
1203426954 Un_GL000195v1:49935-49957 AGTAGGCTTGGACACCTGCAGGG - Intergenic
1187035960 X:15539518-15539540 AGCAGTTTTGGAGACCTGCATGG - Intronic
1190719499 X:53135756-53135778 AGTTGGCTGGGACTTCTGCAAGG - Intergenic
1193393576 X:80957866-80957888 AGAAGGCCTGGACAGCTGCCTGG - Intergenic
1193689479 X:84622848-84622870 AGGAGGCTGGGAACCCTGCATGG - Intergenic
1194502178 X:94695150-94695172 AGGAGGCTTGGAACCCTGCATGG - Intergenic