ID: 1176468345

View in Genome Browser
Species Human (GRCh38)
Location 21:7080223-7080245
Sequence CACCTGCAGGGCAGACACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 6, 1: 0, 2: 5, 3: 34, 4: 338}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176468339_1176468345 7 Left 1176468339 21:7080193-7080215 CCTTCCATGGTTGGTGTGAGTAG 0: 5
1: 1
2: 5
3: 12
4: 152
Right 1176468345 21:7080223-7080245 CACCTGCAGGGCAGACACCCAGG 0: 6
1: 0
2: 5
3: 34
4: 338
1176468341_1176468345 3 Left 1176468341 21:7080197-7080219 CCATGGTTGGTGTGAGTAGGCTT 0: 5
1: 1
2: 0
3: 9
4: 105
Right 1176468345 21:7080223-7080245 CACCTGCAGGGCAGACACCCAGG 0: 6
1: 0
2: 5
3: 34
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176468345 Original CRISPR CACCTGCAGGGCAGACACCC AGG Intronic
900157729 1:1210237-1210259 TTCCCGCAGGGAAGACACCCCGG - Intergenic
900166016 1:1244662-1244684 CACCAGCAGGGCAGGCATGCGGG + Intronic
900464492 1:2818443-2818465 CCCCTGCAGGGCAGGCAGCAGGG - Intergenic
900472509 1:2861769-2861791 CGCCTGCAGGGCAGAGATGCTGG - Intergenic
900640964 1:3687881-3687903 CAGTGGCAGGACAGACACCCGGG + Intronic
900888234 1:5430398-5430420 CACCTGGAGGAGAGACACCCAGG - Intergenic
901489542 1:9589558-9589580 AATCTGCAGGGCAGACCCCGAGG + Intronic
902182602 1:14700746-14700768 CAGCTGCAAGGAAGCCACCCTGG - Intronic
902333717 1:15743124-15743146 CACCACGAGGGCAGCCACCCGGG - Exonic
903026108 1:20430823-20430845 CAGCTGGAGGGCAGAAACCCAGG - Intergenic
904260558 1:29285232-29285254 CATAAGCAGGGCAGACACCTTGG - Intronic
904496270 1:30888540-30888562 CACATGCTGAGCATACACCCTGG + Intronic
904876446 1:33658172-33658194 CTCCTGAGTGGCAGACACCCAGG - Intronic
905401014 1:37703314-37703336 CAACTCCAGGCCTGACACCCAGG + Exonic
906514641 1:46431752-46431774 CCCCTGAAGGCCAGCCACCCAGG + Intergenic
906614600 1:47225690-47225712 CACCGGCAGGGCCGCCCCCCGGG + Exonic
910670803 1:89770860-89770882 CAGCTGCAGGGGAGACACTAGGG - Intronic
912708268 1:111930856-111930878 CCACTGGAGGGCACACACCCAGG + Intronic
912722746 1:112033866-112033888 CATCTGCAGGCTGGACACCCAGG + Intergenic
915075802 1:153307368-153307390 CCCATGCATGGGAGACACCCTGG + Intronic
915316506 1:155031779-155031801 CAGCTGCAGGGTTGGCACCCAGG + Intronic
916242116 1:162650639-162650661 CACATGCAGCCCAGACTCCCAGG + Intronic
916470667 1:165119285-165119307 CCCCTGCCGGGCTGCCACCCTGG + Intergenic
917738260 1:177939583-177939605 CACAGGCAAGGCAGGCACCCTGG + Intronic
917764144 1:178199036-178199058 GAACTGCAGGGCAGCCAGCCTGG - Intronic
920318448 1:205097393-205097415 CCCCTGCAGGACAGAAACACAGG + Exonic
920934603 1:210419297-210419319 CACCTCCCTGGCAGACACACAGG - Intronic
921054948 1:211536636-211536658 CACTGGGAGGGCAGAGACCCAGG - Intergenic
922469226 1:225865711-225865733 CACCAGCAGGGCTGGCACACAGG + Intronic
922783614 1:228272429-228272451 CCACTGCAGGGCACACACCATGG - Intronic
923271254 1:232357160-232357182 CACCTCCACTGCAGCCACCCCGG - Intergenic
924382039 1:243474392-243474414 CACCTGGAGGGCAGCCGGCCGGG - Intronic
924560995 1:245156262-245156284 CACCTGCGGGGAAGACACGCCGG - Exonic
1063137319 10:3229041-3229063 TTCCTGCAGGTGAGACACCCTGG - Intergenic
1063424988 10:5943787-5943809 CACCTGCAGGGCAGTGTCACGGG + Intronic
1065045470 10:21744459-21744481 GCCCTGCAGGGCAGCAACCCAGG - Intergenic
1067407017 10:46032465-46032487 CATCTGCAAGGCAGAGCCCCTGG + Intergenic
1069058004 10:63864988-63865010 CACCTGCAGCCCAGAAATCCAGG + Intergenic
1071733959 10:88277312-88277334 CACCTCCCCGGCAGGCACCCTGG - Intronic
1072617052 10:97056899-97056921 CTCCTGCAGGGGGGACACCCAGG - Intronic
1073041768 10:100612713-100612735 TTCATGCAGGGGAGACACCCCGG - Intergenic
1076477351 10:130761957-130761979 CAGCTGCAGGGGACGCACCCGGG + Intergenic
1076508274 10:130993389-130993411 CCCCTCCAGGGCAGCCACGCTGG + Intergenic
1076947032 10:133658499-133658521 ATCCTGCAGAGCACACACCCAGG + Intergenic
1077026183 11:441076-441098 CACATCCAGGTCTGACACCCTGG - Intronic
1077118094 11:894451-894473 CACCTGCAGGGTAGACTCATGGG - Intronic
1077971513 11:7196917-7196939 CACCAGCATGGCAGAGATCCAGG + Intergenic
1078290801 11:10008069-10008091 CTCCTACAGGGTAGCCACCCGGG - Intronic
1078626806 11:12965347-12965369 CCCATGCAGGGAAGACCCCCTGG - Intergenic
1079393906 11:20045194-20045216 CACCAGCAGGTCAGCCACACTGG + Exonic
1081694161 11:45098105-45098127 CACCTTCAGGGAACCCACCCAGG + Intronic
1082895421 11:58184927-58184949 TACCTGCTGGGCAGAAACCCAGG + Intergenic
1083654571 11:64223293-64223315 CACCTGAAGGGCAGACAGAGGGG - Exonic
1083693955 11:64430207-64430229 CACCTGCAGATCAGAAGCCCAGG - Intergenic
1084427242 11:69091615-69091637 AAGCTGCAGGTCAGACATCCAGG + Intergenic
1089328547 11:117674210-117674232 CACCTGCCAGGCACACACCAGGG - Intronic
1089642088 11:119854405-119854427 GACTAGCAGGGCAGAGACCCCGG - Intergenic
1090071062 11:123545125-123545147 CTCCTCCAGGGCAGCCGCCCCGG + Intronic
1090276359 11:125422510-125422532 TGCCAGCAGGGCACACACCCTGG - Intronic
1090716500 11:129436568-129436590 CAGCTGCAGGGCAGGCACAGAGG - Intronic
1090753651 11:129769791-129769813 CATCTGCAAGTCAGAGACCCAGG + Intergenic
1091249732 11:134132926-134132948 AACCTGCAGAGCAGAAACTCAGG - Intronic
1091684353 12:2550936-2550958 AATCTGCAGTGCAGACTCCCTGG - Intronic
1092162874 12:6325636-6325658 CAGCTTCAGGGCAGAGGCCCAGG + Intronic
1092202942 12:6598219-6598241 TACCTGCAGTTCAGAAACCCAGG + Exonic
1092974160 12:13728067-13728089 CCCCTCAAGGGCAGAAACCCTGG + Intronic
1095088858 12:38086069-38086091 AGCCTGCAGAGCACACACCCAGG - Intergenic
1096453782 12:51768897-51768919 CTCCTTCAGTGCAGACAACCTGG + Exonic
1097333702 12:58359131-58359153 AGCCTGCAGGGCAGAAAGCCTGG + Intergenic
1098299860 12:69043165-69043187 CTCCTGCAGGTCAGCCTCCCAGG + Intergenic
1099887398 12:88548494-88548516 CACAAGCAGAGCAGACTCCCAGG + Intronic
1100811668 12:98344918-98344940 AACCTGAAGGCCAGAGACCCAGG - Intergenic
1102404210 12:112658611-112658633 CACCTGCACAGCTGACACCCTGG - Intronic
1102459265 12:113090203-113090225 CACCTCTAGTGCAGACAACCTGG - Intronic
1103725676 12:122996381-122996403 AACAGGCAGGGCAGCCACCCTGG + Intronic
1103779844 12:123390946-123390968 AACCAACAGGGCACACACCCTGG - Intronic
1103936104 12:124477716-124477738 CACCTGCAGGCCTGACCGCCAGG - Intronic
1104559690 12:129832642-129832664 CACCTGCCGGGCAGAGGCCTGGG - Intronic
1105054158 12:133081564-133081586 CACCTGCCTGGCAGAACCCCAGG + Intronic
1105929694 13:25041045-25041067 CACCTGCAAACCTGACACCCTGG + Intergenic
1106006938 13:25779430-25779452 CACCCCCAGTGCAGACACACAGG - Intronic
1106411059 13:29511735-29511757 CACATGCAGGGCAGTCACAGGGG + Exonic
1111204442 13:84986139-84986161 CACATGCAGGTTAGACTCCCTGG + Intergenic
1112325113 13:98438784-98438806 CTCCTGCAGGGGAGACAGACCGG - Exonic
1113198511 13:107837674-107837696 CACCAGCTGCGCAGACTCCCAGG + Intronic
1113313665 13:109156805-109156827 CTCCTGCACGGCAGTCACCTGGG + Intronic
1113777795 13:112958626-112958648 CACCTGCCTGGCACACGCCCAGG + Intronic
1113901272 13:113799529-113799551 CAGCTGCAGGGGTGACCCCCAGG - Intronic
1117455952 14:55896943-55896965 CAACTCCAAGGCAGACAGCCTGG - Intergenic
1118314701 14:64718803-64718825 CATCTGCAGGGTAGACATCTGGG - Intronic
1119312832 14:73664293-73664315 CACCTGAAGGGCAGAAAGACAGG - Intronic
1121024079 14:90601644-90601666 CACCTGCAGGGGAGCGCCCCGGG + Intronic
1121260187 14:92560160-92560182 CCCCAGCAGGGGAGGCACCCAGG + Intronic
1121325160 14:93015602-93015624 CACTGGCAGGGCAGACGCCCTGG + Intronic
1121486854 14:94323033-94323055 CCCCTGCATGGCAGGAACCCAGG + Intronic
1122307304 14:100773913-100773935 CACCTGTAGGGCAGACAGGGAGG + Intergenic
1122744058 14:103887712-103887734 CACCTGCTGTGCACCCACCCTGG + Intergenic
1122876190 14:104666419-104666441 CACCTGCAGGGCATCTTCCCCGG + Intergenic
1124632543 15:31345766-31345788 GGCTGGCAGGGCAGACACCCGGG - Intronic
1128306893 15:66604581-66604603 CTCCTGCAGGGCAGAGACATGGG + Intronic
1130048946 15:80467545-80467567 CACTTGCCCGCCAGACACCCTGG - Intronic
1132646856 16:1003209-1003231 CAGCTGCAGGGAAGGCCCCCGGG - Intergenic
1132656867 16:1045067-1045089 CGCCTGCAGTGCGGACGCCCTGG - Intergenic
1132764260 16:1526399-1526421 CACCTGACAGGCACACACCCTGG + Intronic
1133234505 16:4381659-4381681 CTCCTGCAGGGCAGCCAGGCCGG - Exonic
1133723323 16:8515294-8515316 GACCTAGAAGGCAGACACCCTGG - Intergenic
1134042675 16:11080458-11080480 CATCTGCAGTGAAGACACACAGG + Intronic
1134237746 16:12480832-12480854 CTCCTGCACAGCAGAGACCCAGG - Intronic
1135137399 16:19895227-19895249 CTCCTGCATGGCAGCCACCCTGG - Intergenic
1136025498 16:27465670-27465692 CACCTGCTGGGTGGACACACTGG + Intronic
1137274152 16:46922517-46922539 CACCTGCAGGCCACACCCTCAGG - Intronic
1137578075 16:49617089-49617111 CTGCTGGGGGGCAGACACCCAGG + Intronic
1137578925 16:49621669-49621691 CAGCGGCAGGGCAGCCACTCTGG + Intronic
1138207221 16:55133856-55133878 TACCTGCAGGGAAGAGACCCTGG - Intergenic
1138558599 16:57787012-57787034 CACGTGCAGGCCACACAGCCAGG - Intronic
1138675946 16:58651205-58651227 CACCTGCAGTGCACACACCCTGG + Intergenic
1139472466 16:67185466-67185488 CAGCTGCAGGACAGACACTGAGG + Exonic
1139560216 16:67737017-67737039 CACATGCAGGGCCTCCACCCAGG - Intronic
1139910276 16:70393446-70393468 GACCTGCAGGGCTTCCACCCAGG + Intronic
1139964443 16:70737658-70737680 CATCTGCAGGGCTGGCTCCCCGG - Intronic
1140266633 16:73426970-73426992 CAAGTGCAGGCCAGACACCCAGG - Intergenic
1141696263 16:85621120-85621142 CCCCAACAGGGCAGAGACCCAGG - Intronic
1141809910 16:86368891-86368913 CACATGCAGTGCCCACACCCAGG - Intergenic
1142899265 17:3002376-3002398 CACCTGCCAGGCAGACACTGAGG + Intronic
1143264519 17:5626062-5626084 CACCTGCAAGGGAGGCTCCCCGG + Intergenic
1143513142 17:7406677-7406699 GACCGGAGGGGCAGACACCCAGG - Intronic
1144649954 17:17001233-17001255 CACCTGGAGGGCAGCAGCCCAGG + Intergenic
1145904744 17:28509907-28509929 CACAGGCAGGGTAGAGACCCGGG - Intronic
1145979635 17:29004129-29004151 CACTTGAAGTGCAGACACACTGG + Intronic
1146559817 17:33858353-33858375 ACCCTGCAGGGCAGCCACACTGG - Intronic
1146628386 17:34452301-34452323 CATATGCAGGACAGACACCAAGG - Intergenic
1147135044 17:38429346-38429368 CTCCTGCAGGGCGGGCAGCCAGG - Intronic
1147905455 17:43819606-43819628 CTCCTCCAGGGCAGAAACCCTGG + Intronic
1148872965 17:50669208-50669230 TCCCAGCAGGGCAGACACCAGGG - Exonic
1149661172 17:58334717-58334739 CACCTGCTGGTCAGTCACACAGG - Intergenic
1149662849 17:58344562-58344584 CACGTCCGGGTCAGACACCCAGG + Intergenic
1151686562 17:75650616-75650638 TGCCTGCAGGAGAGACACCCAGG - Intronic
1151748183 17:76022664-76022686 GAGCTGCAGGGCATGCACCCGGG - Intronic
1151829025 17:76538746-76538768 CCGCTGCAGGGCAGGCACCATGG - Intronic
1151886060 17:76924009-76924031 CCCCTGCAGGGGAGAAACCGAGG + Intronic
1152130827 17:78475389-78475411 CACCAGCAGGGCATTCCCCCGGG + Exonic
1152283989 17:79401995-79402017 TACCTGCAGAGCAGCCACCTGGG + Intronic
1152437130 17:80283318-80283340 CACCTGCAGGGCTGACACCTCGG - Intronic
1152568804 17:81112276-81112298 CCCTTGGAGGGCAGAGACCCTGG + Intronic
1152607912 17:81302360-81302382 AAACTGCACGGCAGACACCAGGG - Intergenic
1203166879 17_GL000205v2_random:105560-105582 TGTCTGCAGGGCAGACACCCAGG - Intergenic
1153541443 18:6160069-6160091 CACCAGCAGGGCAGCCCCCCAGG - Intronic
1155505482 18:26528720-26528742 AAGCTGCAGGACACACACCCAGG + Intronic
1156275566 18:35580964-35580986 CACCGCCGGGGCAGGCACCCGGG - Intergenic
1156484478 18:37456195-37456217 CTTCTCCAGGGCAGACACCCTGG + Intronic
1157188381 18:45559922-45559944 CTCCTGAAGGCCAGACACCTTGG - Intronic
1159908823 18:74123874-74123896 GATCTGCAGGACAAACACCCAGG + Intronic
1160232255 18:77057277-77057299 CAGCTGCCAGGCAGACACTCAGG - Intronic
1160563348 18:79772371-79772393 CACCTGCACAGCACACACCACGG + Intergenic
1160709373 19:544079-544101 CACCAGCAGTGAAGACACGCAGG - Exonic
1160838203 19:1134385-1134407 CTCCTGCAGCGCAGTCACCACGG + Intronic
1160838733 19:1136918-1136940 CACCTGCCGGGCATCCATCCCGG - Intronic
1161302077 19:3547624-3547646 CAGCTGCAGGGCGCCCACCCTGG - Intronic
1161901517 19:7122987-7123009 CACCTGCAGAGCAAGCAACCAGG + Exonic
1162096253 19:8311701-8311723 GACCTGCAGGACAGACAGCAGGG + Intronic
1162760947 19:12887770-12887792 CTGCTGCAGGGCTGAGACCCTGG - Intergenic
1162906204 19:13825635-13825657 CGCCTGCAAGACAGCCACCCCGG + Exonic
1163126473 19:15246855-15246877 CATGTGCACGGCAGACCCCCAGG + Intronic
1163171062 19:15531467-15531489 CATCTCCAGGGCTGCCACCCAGG + Intronic
1163312981 19:16525239-16525261 CACCGGCAGGGAAGTCCCCCTGG + Exonic
1165073466 19:33268585-33268607 CACCAGGAGGGCAGACTCCCTGG - Intergenic
1165324149 19:35104479-35104501 CACCTGGAACACAGACACCCAGG - Intergenic
1165958402 19:39515839-39515861 CACCTTCAGGGCAGACCCGTCGG + Exonic
1166016074 19:39980297-39980319 CACAAACAGAGCAGACACCCTGG + Exonic
1166810222 19:45509687-45509709 CACCTGCAGGGGAGACCCCCTGG - Intronic
1167085920 19:47309720-47309742 CCTCTGCGGGGCACACACCCAGG - Intronic
925342374 2:3146415-3146437 CAGCTGCTAGGCAGAAACCCCGG + Intergenic
925710108 2:6731051-6731073 CTCTTGCAGGGCAGAGTCCCAGG + Intergenic
925857862 2:8148041-8148063 AACCTGCAGGGCAGGCATGCAGG + Intergenic
926166760 2:10525975-10525997 CTCCTGCAGGGCAGAGGGCCAGG - Intergenic
926621135 2:15048317-15048339 AATGTGCAGGGCACACACCCAGG + Intergenic
926779458 2:16454709-16454731 GACCTGTAGGGGAGGCACCCTGG - Intergenic
926812757 2:16771041-16771063 CACCCCCAGGGGAGACTCCCTGG - Intergenic
929489734 2:42385601-42385623 CATGTGCATGGGAGACACCCGGG + Intronic
929863336 2:45697625-45697647 CACCTGCAGGGATGTCACCTAGG - Intronic
930536115 2:52648285-52648307 CACCTGCAGGTCCAACACCATGG + Intergenic
931675266 2:64688545-64688567 CATCTGCAAGGCAGCCACCGAGG + Intronic
933651935 2:84856625-84856647 CACCAGGAGGGCACACAGCCTGG + Intronic
934061834 2:88301865-88301887 AAACTGCAGGCCACACACCCTGG + Intergenic
934792233 2:97071058-97071080 CACTTGGAGGGCAGACATCCAGG + Intergenic
934814385 2:97312651-97312673 CACTTGGAGGGCAGACATCCAGG - Intergenic
934823308 2:97395832-97395854 CACTTGGAGGGCAGACATCCAGG + Intergenic
935334297 2:102000937-102000959 CATCTGCAGGGCAAACCCACAGG - Intronic
935652433 2:105393586-105393608 CACCAGCAGGGAACACACACAGG + Intronic
936044495 2:109176113-109176135 CAAGTAAAGGGCAGACACCCAGG - Intronic
938548114 2:132353239-132353261 CTGCTGCAGGGCAGACCGCCTGG - Intergenic
940820023 2:158342720-158342742 CACCTGCAGATAAGACACCCTGG - Intronic
940972245 2:159906559-159906581 CCCCCGCAGGGCAGCTACCCTGG - Intergenic
947592212 2:231392304-231392326 CACCAGCAGGGCAGTGCCCCGGG - Intergenic
948508767 2:238448975-238448997 CACCTGCAGGCCAGCCAGGCTGG - Exonic
948533340 2:238627813-238627835 CACCTGCAGGCTGGAGACCCAGG - Intergenic
948636433 2:239340788-239340810 CCCCTCCAGGCCAGGCACCCTGG + Intronic
948803133 2:240441813-240441835 CACCTCCAGGCCCCACACCCAGG + Intronic
948980982 2:241494621-241494643 GACCTGCAGGGCAGGCCCCTGGG - Exonic
949060543 2:241953937-241953959 AGCCTGCAGGGCAGCCACCCCGG - Intergenic
1169910283 20:10642512-10642534 GCCCTGGAGGGCAGACACACCGG + Exonic
1170544108 20:17418711-17418733 CACCAGCTGTGCAGACACCAAGG + Intronic
1170729426 20:18960120-18960142 CACCTGCAGGCCAGAGTCCTTGG - Intergenic
1171876983 20:30586011-30586033 CTGCTGCAGGGCAGACCGCCTGG - Intergenic
1172321271 20:33996988-33997010 CAGCTCCAGGGCAGGAACCCAGG + Intronic
1173117867 20:40263264-40263286 CACCTTCTGTGCATACACCCCGG - Intergenic
1173855568 20:46248331-46248353 CAGCTGCTGGGCAGACAGCAAGG + Intronic
1174178015 20:48657171-48657193 CACCTGCAGGCCAGCCACCTGGG + Exonic
1174224993 20:48990959-48990981 CATCTGCAGGGCTGGCACACTGG - Intronic
1175077824 20:56391038-56391060 CACCTGAAGGGCAGTCTCCTTGG - Intronic
1175109602 20:56637880-56637902 GTTCTGCAGGGCAGACACCGCGG - Exonic
1175404027 20:58715658-58715680 CACCTGCGTGGCTGACAGCCAGG + Exonic
1175888396 20:62304914-62304936 CACCAGCAGGGAAGCCACACAGG - Intronic
1176334683 21:5584997-5585019 CACCTGCAGGGCAGACACCCAGG + Intergenic
1176393074 21:6235951-6235973 CACCTGCAGGGCAGACACCCAGG - Intergenic
1176404876 21:6353537-6353559 TGTCTGCAGGGCAGACACCCAGG + Intergenic
1176432281 21:6635567-6635589 TGTCTGCAGGGCAGACACCCAGG - Intergenic
1176468345 21:7080223-7080245 CACCTGCAGGGCAGACACCCAGG + Intronic
1176491906 21:7462001-7462023 CACCTGCAGGGCAGACACCCAGG + Intergenic
1176508736 21:7676382-7676404 CACCTGCAGGGCAGACACCCAGG - Intergenic
1178721905 21:35017785-35017807 GAGCTGCAGGGCATTCACCCGGG + Intronic
1179519186 21:41931256-41931278 ACCCTGCAAGGCAGGCACCCAGG + Intronic
1179576786 21:42312964-42312986 CAGGTGCAGGGCAACCACCCTGG - Intronic
1179916366 21:44480732-44480754 CAACTCCAGGCCAGACACACTGG + Intergenic
1179921905 21:44512091-44512113 GAACTGCAGGACAGACACACAGG + Intronic
1180887029 22:19253228-19253250 TACCTACAGTGCAGACACACGGG + Intronic
1181235441 22:21445540-21445562 CGCCAGCTGGGCAGACAGCCCGG - Exonic
1181287050 22:21760033-21760055 CCACTGCTGGGCAGACATCCTGG - Exonic
1181543715 22:23588576-23588598 CACCTGCTGGGCAGACAGTAGGG - Intergenic
1182049228 22:27300323-27300345 CCCCTGCAGGGAAGGCATCCCGG - Intergenic
1184176574 22:42792625-42792647 CACCTTCAGAGCAGACTCCTGGG - Intergenic
1184419842 22:44373404-44373426 CCCCTGCAGGGCAGAGGCCAAGG - Intergenic
1185322389 22:50207763-50207785 CCCCTGGGGGGCAGTCACCCTGG + Intronic
1185418151 22:50721048-50721070 CGGCTTCAGGGCAGACACCGGGG - Intergenic
949893668 3:8753074-8753096 TACCTGAAGGGCAGACGCCTGGG - Exonic
950042580 3:9929832-9929854 CACCTGCTGGGAAGAGACCATGG - Exonic
950151391 3:10690060-10690082 CAACTGCAGAGCAGACACAAAGG + Intronic
950209956 3:11115916-11115938 CATCTGCAGGGCAGAATACCAGG - Intergenic
951056873 3:18157457-18157479 CACCTGCATGACAGACTCCAAGG + Intronic
951767359 3:26214939-26214961 CACTTGCAGAGAAGACAGCCTGG + Intergenic
952738632 3:36714447-36714469 TACCTGCAGGGCATACACCCAGG - Exonic
952846315 3:37690699-37690721 AACAAGCAGGGCAGGCACCCTGG + Intronic
954008603 3:47614637-47614659 CACTTCCACGGCTGACACCCTGG + Intronic
954138265 3:48592246-48592268 CACCTGCATGGGGGACACCAAGG + Exonic
954320581 3:49829764-49829786 CTCCTGCAGGGAAGACCCCAGGG + Exonic
954802123 3:53193501-53193523 CACCTGCACGACAGGCACACTGG - Intergenic
954937462 3:54339594-54339616 CTCCTGTAGTGCAGACATCCAGG + Intronic
955179680 3:56655659-56655681 CACCTGCAGCCCAGCTACCCAGG + Intronic
955641995 3:61095788-61095810 CTCCTGCAAGGCAGAGAGCCTGG + Intronic
955724837 3:61922257-61922279 AACATGCAGGGCAGATATCCAGG - Intronic
955904746 3:63794940-63794962 CACCTGCAGGGCAGAAAAGGTGG - Intergenic
956659577 3:71584116-71584138 CACCTGCTGGGTAAACAACCGGG + Intergenic
957835876 3:85588764-85588786 CAGCATCAGGGCAGACACTCTGG + Intronic
958807270 3:98826776-98826798 AACCTGCAGGGAAGAAAACCTGG + Intronic
960523002 3:118677400-118677422 CTCCTGCAGGGCAGTTCCCCAGG - Intergenic
961037230 3:123650999-123651021 GAGCTCCAGGGCAGGCACCCAGG - Intronic
961371245 3:126433306-126433328 CAGCTGCAGGGCACTCACCCGGG - Intronic
961646780 3:128397041-128397063 CACTTCCAGGGCAGAGGCCCAGG - Intronic
961864669 3:129944938-129944960 CACCTCCAGAGCAGCCACCCTGG - Intergenic
962763869 3:138543230-138543252 GTCCTGCAGTGCAGACAGCCTGG - Intronic
967895970 3:194396753-194396775 CACCGGCTGGGCCCACACCCAGG + Exonic
968568758 4:1328543-1328565 CACCTGCTGGGCACTCGCCCGGG - Intronic
968961725 4:3748987-3749009 CACCTGGATGGCAGTCCCCCAGG + Intergenic
969588551 4:8108478-8108500 CAGCTGCATGGCAGACTCGCGGG + Intronic
969626491 4:8308219-8308241 CATTTGCAGGGCAGACACAGGGG - Intergenic
969838436 4:9862426-9862448 CACATACATGGGAGACACCCAGG - Intronic
970457412 4:16238751-16238773 AACCTGCAGTGAAGACACCAGGG - Intergenic
971277910 4:25215548-25215570 CACCTGCAGGCCCAACACCATGG + Intronic
971918707 4:32909555-32909577 TCCCAGCAGGGCAGCCACCCAGG + Intergenic
976820896 4:89205885-89205907 CACCTGTAGTGGAGCCACCCAGG + Intergenic
985450491 4:190059298-190059320 GTCCTGCAGAGCACACACCCAGG + Intergenic
985621881 5:960202-960224 CACCGGGAGGGCAGGCACACCGG - Intergenic
986044651 5:4025372-4025394 CACCTGCAGGAAGGAAACCCAGG + Intergenic
986064570 5:4223051-4223073 CACCTGGACTGCAGCCACCCCGG + Intergenic
988456578 5:31392335-31392357 CACCTTGTGGGCAGACACCAGGG + Intergenic
991042312 5:62188609-62188631 CATCTGCAGAGCAGACACTGGGG - Intergenic
996595406 5:125196453-125196475 CACCTGCAGTGCGGACATGCAGG - Intergenic
997224482 5:132198657-132198679 CATCTACAGGGGAGACAGCCAGG + Intronic
998215586 5:140236414-140236436 CACCAGCACGGCAGGCACCTCGG + Intronic
998229279 5:140349415-140349437 CAAGTGCAGAGCAGAAACCCTGG + Intergenic
999115264 5:149157406-149157428 AACATGCTGAGCAGACACCCTGG - Intronic
999204445 5:149837940-149837962 GACCTACAGATCAGACACCCGGG - Intronic
999285634 5:150392715-150392737 CCCCTCCAGGACAGAGACCCTGG + Exonic
999698459 5:154206791-154206813 CTCCTGCAGGCCAGCCTCCCTGG - Intronic
1001085740 5:168699028-168699050 CCCCTCCAGGGCACACAGCCTGG - Intronic
1001403998 5:171462785-171462807 CAGCTGCAGGGCGGTCAGCCTGG - Intergenic
1001982868 5:176048239-176048261 CAGCTGCCAGGCTGACACCCAGG - Intergenic
1002114632 5:176949712-176949734 TACCTGCAGCGCAGAGACCAGGG + Intronic
1002159564 5:177307347-177307369 CCCCTGCAGGGCAGGCAGCTTGG - Exonic
1002234595 5:177795818-177795840 CAGCTGCCAGGCTGACACCCAGG + Intergenic
1002549060 5:179973570-179973592 CACCTGCAGGGCCATCACACGGG + Intronic
1002576596 5:180177449-180177471 CACGGGCAGGGCAGAGCCCCGGG + Intronic
1007288995 6:40770108-40770130 CCCCTCCAGAGCAGACCCCCAGG + Intergenic
1007372927 6:41438509-41438531 AACCTCCAGGGCAGGCTCCCAGG + Intergenic
1007431686 6:41780522-41780544 CACCTGCATGGCAGAGGCCATGG + Intronic
1008589222 6:52976451-52976473 CACCTGTTGGGCAGTCAGCCAGG - Intergenic
1011643756 6:89438269-89438291 CACCTGAAGGACAGCTACCCAGG - Intronic
1013011249 6:106122509-106122531 CACCTGCAGGCCTGACCCACAGG - Intergenic
1013176382 6:107680826-107680848 CACCAGAAGGGCAGTCACGCTGG + Intergenic
1014398827 6:120961940-120961962 CAACTGCAGGGGAGCCAGCCAGG - Intergenic
1015044317 6:128760220-128760242 CCCCTGGTGGGCAGACCCCCAGG + Intergenic
1016885406 6:148955209-148955231 CTCCTGCAGGCCAGGCACCAAGG + Intronic
1017748636 6:157469591-157469613 GAGCTGCAGGGCAGAATCCCAGG - Intronic
1018900622 6:168050081-168050103 CCCCCGCAGGGAAGCCACCCCGG - Intergenic
1019326166 7:439323-439345 AATCTGCAGGGCAGACCCGCAGG - Intergenic
1019652754 7:2169561-2169583 CACCTGCAGTGTAGACACACTGG - Intronic
1022585632 7:31605955-31605977 CACCTGCATGGCAGTCTCACAGG + Intronic
1023623649 7:42096059-42096081 TCCCTGCAGTGCACACACCCTGG - Intronic
1024054011 7:45648150-45648172 CACCCACAGGGCACACTCCCAGG - Intronic
1025061298 7:55810851-55810873 CAACTCCAGGCCTGACACCCAGG - Intronic
1026602796 7:71790553-71790575 CAACTGCAGGACAGACAGCAAGG - Intronic
1026899412 7:74028548-74028570 CCCCTACAGGGCGGGCACCCGGG - Intronic
1026902426 7:74044560-74044582 CTCCTGCAGGGCAGACTCATTGG - Intronic
1028617154 7:92781278-92781300 CAGCTGCAGGGCAGAGAACAAGG + Intronic
1028752404 7:94395201-94395223 CACTTGGAGGGCAGACTCTCAGG + Intronic
1028812448 7:95103113-95103135 GGCCTGCAGGCCAGAGACCCAGG - Intronic
1029186287 7:98741186-98741208 CACCTGCAGAGCATCCATCCGGG + Intergenic
1030216586 7:107049261-107049283 CACATGCAGAGCAGTCAACCTGG + Intronic
1032484806 7:132277423-132277445 CTCCTGCAGGGCAGACACCAGGG - Intronic
1034118614 7:148606997-148607019 CATCTACATGGCAGACACCCAGG + Intronic
1034732742 7:153401926-153401948 CACCTGCTGGGGAGCCTCCCGGG + Intergenic
1035106617 7:156446485-156446507 CACCTCCATGTCAGAGACCCTGG - Intergenic
1035521946 8:281887-281909 CATCTGCAAGGCAGAGATCCGGG - Intergenic
1035770393 8:2142641-2142663 AACCTGCAGCCCAGACACCCAGG + Intronic
1038481720 8:27906522-27906544 GGCCTGCAGGGCAGACACCAGGG - Intronic
1038585042 8:28780742-28780764 CACCTACAAGGTAGAGACCCAGG - Intronic
1039688180 8:39831166-39831188 CACCTGCTGTACAGAGACCCTGG + Intronic
1040519212 8:48160535-48160557 CTGGTGCAGGGCAGACATCCAGG + Intergenic
1041243158 8:55866398-55866420 CACCTGCAGTCCAGCTACCCAGG - Intergenic
1042520339 8:69704855-69704877 CTCCTGCAGGGCAGAAGCCAGGG - Intronic
1048995725 8:139792661-139792683 CTTGTGCAGTGCAGACACCCAGG - Intronic
1049340073 8:142107381-142107403 CAGCTGGAGGGCAGACACGCTGG + Intergenic
1049562638 8:143319418-143319440 CACCTGTAGTCCAGACACCTTGG - Intronic
1049687616 8:143945205-143945227 CACGCGCAGGCCAGAGACCCAGG + Intronic
1049777187 8:144412197-144412219 CACCTGCTGCCCACACACCCGGG + Intronic
1052872639 9:33523661-33523683 CTGCTGCAGGGCAGACCGCCTGG - Intergenic
1052895154 9:33740816-33740838 CATCTGCAAGTCAGAGACCCAGG + Intergenic
1052926568 9:34021955-34021977 CACCTTCAGGCCAGGCACCGTGG + Intronic
1053348003 9:37392311-37392333 ATCCTGCATGGCAGAGACCCTGG + Intergenic
1053752321 9:41269192-41269214 CTGCTGCAGGGCAGACCGCCTGG + Intergenic
1053752771 9:41273449-41273471 CTGCTGCAGGGCAGACCGCCTGG + Intergenic
1054257848 9:62833524-62833546 CTGCTGCAGGGCAGACCGCCTGG + Intergenic
1054258296 9:62837801-62837823 CTGCTGCAGGGCAGACCGCCTGG + Intergenic
1054333474 9:63782240-63782262 CTGCTGCAGGGCAGACTGCCTGG - Intergenic
1054878458 9:70120974-70120996 CCCCAGTAGGGCAGACAACCTGG - Intronic
1056808607 9:89746925-89746947 CATCTGCAAGCCAGAGACCCAGG + Intergenic
1056850822 9:90082278-90082300 GACCTGCTGGGCAGCCAGCCCGG + Intergenic
1057800929 9:98191350-98191372 CTGCTCCAGGGCAGACACCTCGG + Intronic
1057868572 9:98700898-98700920 CACCTGGAGGAGAGCCACCCAGG + Intronic
1058164705 9:101606386-101606408 GACCTGCCTGGAAGACACCCAGG - Intronic
1059449229 9:114359852-114359874 CAGCTGCTGGCCAGACACCCTGG + Intronic
1060735690 9:126065382-126065404 CCCCTGCAGAGCAGGAACCCAGG - Intergenic
1061372622 9:130206305-130206327 CACCTGCATCCCAAACACCCTGG + Intronic
1061397068 9:130349070-130349092 CTCCTGCCGGGCAGAGAACCAGG + Intronic
1061652423 9:132061671-132061693 CAGCAGCAGGGCTGGCACCCAGG + Intronic
1061764841 9:132875203-132875225 TGGGTGCAGGGCAGACACCCAGG + Intronic
1061914636 9:133743090-133743112 CTCTTCCAGGGCAGACAGCCTGG - Intergenic
1061934295 9:133848815-133848837 CACCGGCTGTGCAGTCACCCAGG + Intronic
1062200186 9:135298779-135298801 CACATGCAGGGCAGGCTCTCTGG - Intergenic
1062271432 9:135711528-135711550 CAGCTGCACGCCAGGCACCCTGG - Intronic
1062426171 9:136507234-136507256 CAGGGGCAGGGCAGGCACCCCGG - Intronic
1062433220 9:136535151-136535173 CAGCTGCAGCCCAGACACCAGGG - Intronic
1062443460 9:136583717-136583739 CACCTGCAGAGGGGACACCCTGG - Intergenic
1062581452 9:137230896-137230918 CACCTGCAGGGAGGAGACACGGG - Exonic
1202800477 9_KI270719v1_random:170574-170596 CTGCTGCAGGGCAGACCGCCTGG - Intergenic
1202800923 9_KI270719v1_random:174856-174878 CTGCTGCAGGGCAGACCGCCTGG - Intergenic
1203426953 Un_GL000195v1:49923-49945 CACCTGCAGGGCAGACACCCAGG - Intergenic
1203439257 Un_GL000195v1:173145-173167 TGTCTGCAGGGCAGACACCCAGG + Intergenic
1186847558 X:13545479-13545501 CACCTGTAGGGCAAAAAGCCAGG - Intergenic
1189146970 X:38665377-38665399 CCCCTGCAGGCCACACGCCCTGG - Intronic
1190887589 X:54543187-54543209 CACCTGCAGGGCAGAGGACCAGG - Exonic
1190929356 X:54934827-54934849 CTCCTGCAGGACACCCACCCAGG + Intronic
1193930547 X:87546378-87546400 CACCTGCAGGTCTAACACCACGG - Intronic
1194145318 X:90254900-90254922 CACCTGCAGGCCCAACACCATGG + Intergenic
1194538538 X:95140961-95140983 TACCTGCAGGGTGGAGACCCAGG + Intergenic
1195588068 X:106589043-106589065 CATCTAGAGGGCAGACACTCAGG - Intergenic
1196237255 X:113297188-113297210 CCCCTGCAGAGAAAACACCCAGG - Intergenic
1196741136 X:119027136-119027158 CAGCTGTGGGGCAGACAGCCTGG - Intergenic
1197767762 X:130070064-130070086 CATCTGCAAGCCAGAGACCCGGG - Intronic
1198694073 X:139317079-139317101 GACCTGCAGGACAGACATCAAGG - Intergenic
1198983104 X:142421898-142421920 CATATGCATGGAAGACACCCAGG - Intergenic
1200491080 Y:3824198-3824220 CACCTGCAGGCCCAACACCATGG + Intergenic
1201980871 Y:19909110-19909132 CACCTGCAGGCCCGACACTATGG + Intergenic