ID: 1176468347

View in Genome Browser
Species Human (GRCh38)
Location 21:7080236-7080258
Sequence GACACCCAGGAATAATCAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 9, 1: 0, 2: 0, 3: 9, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176468339_1176468347 20 Left 1176468339 21:7080193-7080215 CCTTCCATGGTTGGTGTGAGTAG 0: 5
1: 1
2: 5
3: 12
4: 152
Right 1176468347 21:7080236-7080258 GACACCCAGGAATAATCAACTGG 0: 9
1: 0
2: 0
3: 9
4: 95
1176468341_1176468347 16 Left 1176468341 21:7080197-7080219 CCATGGTTGGTGTGAGTAGGCTT 0: 5
1: 1
2: 0
3: 9
4: 105
Right 1176468347 21:7080236-7080258 GACACCCAGGAATAATCAACTGG 0: 9
1: 0
2: 0
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176468347 Original CRISPR GACACCCAGGAATAATCAAC TGG Intronic
900850987 1:5142920-5142942 GCCACCCAGGACTAAGCAAGAGG - Intergenic
900932364 1:5745369-5745391 AAACCCCAAGAATAATCAACAGG + Intergenic
910515018 1:88051132-88051154 GACACCCAAGAAAAATGAATGGG - Intergenic
910564426 1:88627220-88627242 GAAACCCAGGAATAAGAAACAGG - Intergenic
918191961 1:182184273-182184295 GACAAGCAGGAATCAGCAACGGG - Intergenic
923330982 1:232924438-232924460 GACACCCAGGAAGAGTCTTCAGG - Intergenic
924638112 1:245808079-245808101 GGCCCCCAGCAATAATAAACTGG + Intronic
1065979758 10:30880804-30880826 GATATCCAGGAATACACAACTGG + Intronic
1070424063 10:76268326-76268348 GACATCCAGGAATGAGCAACAGG - Intronic
1071167906 10:82828270-82828292 GACACCCAGGAATAAGTGAGAGG + Intronic
1073401616 10:103262075-103262097 TCCACCCAGGAAAAGTCAACAGG + Intergenic
1075054984 10:119211145-119211167 GAGACCCAGGACAAATAAACAGG - Intronic
1076185542 10:128445299-128445321 TACAAACAGGAATAATCAAAAGG - Intergenic
1079594526 11:22225766-22225788 TATATCCAGGAATAATCACCAGG - Intronic
1080158656 11:29144189-29144211 GACACTCTGCAAGAATCAACTGG + Intergenic
1085677102 11:78533045-78533067 GTCACCCTGAAATAATCAAGAGG - Intronic
1087049445 11:93870457-93870479 GTCAACCTGGAATAATCAAAAGG - Intergenic
1087748895 11:101983520-101983542 GAGAACCATGAATATTCAACAGG + Intronic
1090288288 11:125519258-125519280 GGCATCCAGGAATAACCATCAGG + Intergenic
1092762693 12:11823877-11823899 GATACACAGGAAGAATCAAATGG - Intronic
1094293939 12:28882303-28882325 GTCACCCAGGCATAGTAAACAGG - Intergenic
1094534857 12:31311937-31311959 GGCACCCAGGACCAATCAAAAGG - Intronic
1101511959 12:105401426-105401448 CACACCCAAGAATCAACAACTGG - Intergenic
1106262907 13:28083983-28084005 GAAACACAGTAATAATCATCAGG - Intronic
1107799888 13:44095812-44095834 CACAATCTGGAATAATCAACTGG - Intergenic
1109151151 13:58848620-58848642 GCCACCCAGGAAGACTCCACAGG - Intergenic
1112193061 13:97196678-97196700 GACACCCAGGATTCATCACCCGG - Intergenic
1115467528 14:33731971-33731993 GAGACACAGGAAAAATCTACGGG - Intronic
1122574756 14:102734842-102734864 GACACCCAGGAATTGGCAGCTGG - Intergenic
1122606933 14:102953008-102953030 GACACCCAAGAATCACCGACAGG + Intronic
1122616602 14:103022206-103022228 GACAACCAGGAATTACCTACTGG + Intronic
1127357291 15:58212523-58212545 TACACCCAGAAATAATTAACAGG - Intronic
1128742419 15:70093137-70093159 GACACACAGAAATAATAGACAGG - Intronic
1131388762 15:92030142-92030164 AACACACAGAAAGAATCAACAGG - Intronic
1132111816 15:99107039-99107061 GGGACCCAGGGAGAATCAACAGG - Intronic
1133395784 16:5446466-5446488 GACAACCAGGTTTAATCAACAGG - Intergenic
1135151603 16:20011686-20011708 GACTCCCAGAAATATTGAACAGG + Intergenic
1142796968 17:2315532-2315554 GAAACCCAGGAATAAGAAAGGGG - Intronic
1144249921 17:13406044-13406066 GGCACACAGGAATCATCAAGAGG + Intergenic
1147214456 17:38891092-38891114 GACACGGAGGAATAAGCAAAGGG + Intronic
1147997151 17:44366512-44366534 GACAACCAGAAATATTGAACTGG - Intergenic
1203166878 17_GL000205v2_random:105547-105569 GACACCCAGGAATAATCAACTGG - Intergenic
1153678152 18:7474170-7474192 GATGCCCAGGAATAATCACTGGG - Intergenic
1155220819 18:23684072-23684094 GAAAAACAGGAATAATCAGCTGG - Intergenic
1155395262 18:25380094-25380116 GGCACCCAGGAACATACAACAGG - Intergenic
1156545501 18:37960210-37960232 GCGACCCAGGAATATACAACAGG + Intergenic
1158877768 18:61749399-61749421 GACACCCAGGAATAAGGACTGGG + Intergenic
1160207564 18:76847625-76847647 GACACACAGAAAAAATCAGCCGG - Intronic
1165762882 19:38332586-38332608 AACACCCACGTATCATCAACAGG - Intergenic
1167713911 19:51128567-51128589 GACCCCCAGGACTAATCAGCTGG + Intronic
925628912 2:5869002-5869024 CACACCCAGGAATGCCCAACAGG + Intergenic
930536425 2:52650820-52650842 CAGATCCAGGAATAATCAAGAGG - Intergenic
930867363 2:56135073-56135095 GGCACCCTGGCATAATAAACAGG + Intergenic
938374303 2:130795778-130795800 GCCACCCAGGAGTAACCTACAGG + Intergenic
938648822 2:133359295-133359317 GACACACAGGAATATTGAAGTGG - Intronic
939627883 2:144500883-144500905 GACACCCAGGCACAATGCACTGG + Intronic
943139186 2:183957769-183957791 GACACTCAGTAGTAATCAGCTGG + Intergenic
946107408 2:217383730-217383752 GACCCCCTGGAATAACCAGCAGG + Intronic
947042947 2:225944818-225944840 GACACCCAGAAACAAAGAACAGG + Intergenic
947445009 2:230156692-230156714 GACACCCAGGAAAATAGAACAGG - Intergenic
948110240 2:235449026-235449048 GACAGCCAGGAATAAGCCAGGGG + Intergenic
1172082724 20:32355226-32355248 GACACCCAGGAATTCCCAAAGGG - Intergenic
1172160678 20:32865970-32865992 GGATCCCAGGAATAATTAACTGG + Intronic
1173265547 20:41476452-41476474 GTCTCCCAGCAATAATCAACTGG + Intronic
1174677713 20:52374520-52374542 GAGACCCGGGAATAAAGAACGGG - Intergenic
1176334685 21:5585010-5585032 GACACCCAGGAATAATCAACTGG + Intergenic
1176393072 21:6235938-6235960 GACACCCAGGAATAATCAACTGG - Intergenic
1176404877 21:6353550-6353572 GACACCCAGGAATAATCAACTGG + Intergenic
1176432280 21:6635554-6635576 GACACCCAGGAATAATCAACTGG - Intergenic
1176468347 21:7080236-7080258 GACACCCAGGAATAATCAACTGG + Intronic
1176491908 21:7462014-7462036 GACACCCAGGAATAATCAACTGG + Intergenic
1176508734 21:7676369-7676391 GACACCCAGGAATAATCAACTGG - Intergenic
1178570660 21:33733096-33733118 GACACCCATGAATAACCAAGGGG + Intronic
1183478792 22:38051516-38051538 GACACCCAGGAGGAAGCAGCAGG - Intergenic
1183594051 22:38799125-38799147 GACACCCAGGAATCAGCAATTGG + Intergenic
950090155 3:10289430-10289452 GACACCCAGAAATAAACGGCAGG - Intronic
953327479 3:42024834-42024856 GACAGCCAGGAAGAGTCAAATGG - Intronic
954999782 3:54916881-54916903 GGCAACCAGAACTAATCAACTGG - Intronic
955817188 3:62856950-62856972 GAAACCCAGGAATTATAAAGAGG + Intronic
958987809 3:100803017-100803039 CACCCCCAGGAATAATCATAAGG - Intronic
960122619 3:113962712-113962734 GAAACCCAGGAATATTTACCTGG + Exonic
961587177 3:127941546-127941568 GACACCTATGAAAAATCTACAGG + Intronic
962058686 3:131901960-131901982 GAAACCCAGGGATGAACAACAGG - Intronic
964250245 3:154707155-154707177 GACTCACAGGAATAATGAAAAGG + Intergenic
964313810 3:155422098-155422120 GACAACCTGAAATAATCAAAAGG + Intronic
969387433 4:6863959-6863981 GATTCCCAGGAGGAATCAACTGG + Exonic
972731056 4:41795815-41795837 GTGTCCCAGGAATAAGCAACAGG - Intergenic
974369224 4:60992811-60992833 TACACCTAGGAATAATTAATAGG - Intergenic
974523622 4:63018702-63018724 GATACACAGTAATAATCAAAGGG - Intergenic
995416093 5:111915041-111915063 GACACACAGAAATAGTCAAAGGG - Intronic
996675217 5:126167688-126167710 GACACCCAAGAATTAGCCACTGG - Intergenic
1000040856 5:157484258-157484280 GACACAAAGTAAAAATCAACTGG - Intronic
1004953868 6:20705584-20705606 GACCCCCATGTATAAACAACTGG + Intronic
1007479607 6:42141746-42141768 GAGGCCCAGGAAAAAACAACAGG - Intronic
1015678603 6:135779436-135779458 GACACCCAAGAAGAGACAACAGG - Intergenic
1016386282 6:143533894-143533916 GAGACCCAGGCATAGGCAACTGG + Intergenic
1022500790 7:30881306-30881328 GACACAGAGGAATAAGCACCAGG - Intronic
1022937477 7:35193776-35193798 TACACCCAGGAAAAATGAAGAGG - Intergenic
1023500698 7:40846321-40846343 GACACTCACGAATACTCAAAAGG - Intronic
1031206255 7:118761671-118761693 GCAACCCAGGAATTATCAAAGGG + Intergenic
1031370311 7:120957501-120957523 GACACCCCTTAATATTCAACTGG - Intronic
1033553435 7:142468244-142468266 GAAACGCTGGAATCATCAACTGG - Intergenic
1038103206 8:24403330-24403352 TATACCTAGGAATAATAAACTGG - Intronic
1038413033 8:27373151-27373173 GACACCCAGGCCTAAACATCAGG + Intronic
1041051599 8:53939874-53939896 GACACCCAAGAAATAACAACAGG + Intronic
1041792328 8:61711182-61711204 GACACCCAGACAAAATAAACAGG + Intronic
1052198002 9:25741809-25741831 GAACCCCAGGAAGAATCAGCAGG - Intergenic
1055688809 9:78808009-78808031 GACATCCCTGGATAATCAACTGG - Intergenic
1056690176 9:88801549-88801571 GGGACCCAGGAATATTCCACTGG - Intergenic
1060356974 9:122918121-122918143 GACATGGAGGAATAATCAATAGG + Exonic
1203439258 Un_GL000195v1:173158-173180 GACACCCAGGAATAATCAACTGG + Intergenic
1187283241 X:17878905-17878927 GATATCCAGGAATACTCAATTGG - Intergenic
1191892748 X:65961479-65961501 GACCCCCTAGAATATTCAACAGG + Intergenic