ID: 1176468348

View in Genome Browser
Species Human (GRCh38)
Location 21:7080237-7080259
Sequence ACACCCAGGAATAATCAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 9, 1: 0, 2: 1, 3: 12, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176468341_1176468348 17 Left 1176468341 21:7080197-7080219 CCATGGTTGGTGTGAGTAGGCTT 0: 5
1: 1
2: 0
3: 9
4: 105
Right 1176468348 21:7080237-7080259 ACACCCAGGAATAATCAACTGGG 0: 9
1: 0
2: 1
3: 12
4: 105
1176468339_1176468348 21 Left 1176468339 21:7080193-7080215 CCTTCCATGGTTGGTGTGAGTAG 0: 5
1: 1
2: 5
3: 12
4: 152
Right 1176468348 21:7080237-7080259 ACACCCAGGAATAATCAACTGGG 0: 9
1: 0
2: 1
3: 12
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176468348 Original CRISPR ACACCCAGGAATAATCAACT GGG Intronic
906814021 1:48859186-48859208 ACATCCAGAAATAATAAGCTGGG - Intronic
910741251 1:90520152-90520174 ACACCCAGTAATAATTAAAAAGG + Intergenic
912465980 1:109874188-109874210 ACACCCAAGAATCCTAAACTTGG + Intergenic
916750072 1:167715258-167715280 GCACCCAGGAATAGACAGCTAGG + Intergenic
918991969 1:191708452-191708474 ATTCTCAGGAATAATCAGCTTGG - Intergenic
920671752 1:208009039-208009061 ACACCAAGGAATATCCAACCTGG - Intergenic
920863861 1:209735094-209735116 ACACCTAGGCATAAGGAACTAGG + Intergenic
1066467833 10:35668890-35668912 ACACTCAGGCATAAGCAACCAGG + Intergenic
1066593306 10:37019792-37019814 ACACCACAGAATAATCTACTTGG + Intergenic
1068585939 10:58798583-58798605 ACACCTAAGAATACACAACTTGG - Intronic
1072584873 10:96772676-96772698 ACAGGCAGGAAGAATCCACTGGG + Intergenic
1074751315 10:116590071-116590093 ACACCGAGGCATATTTAACTTGG + Intergenic
1076185541 10:128445298-128445320 ACAAACAGGAATAATCAAAAGGG - Intergenic
1077999881 11:7485246-7485268 ACAGCCAGGAAAAATAAACATGG - Intergenic
1081210157 11:40323075-40323097 ATACCCTAAAATAATCAACTTGG + Intronic
1081903894 11:46654080-46654102 CCACCGTGGAATAATGAACTAGG - Intronic
1098049783 12:66441440-66441462 AGACCGAGGAATAACCAACATGG - Intronic
1101455045 12:104823089-104823111 AAACCCAGACATAATCAACTTGG + Intronic
1101511958 12:105401425-105401447 ACACCCAAGAATCAACAACTGGG - Intergenic
1104854984 12:131897267-131897289 AAACCCAGGAAAAAATAACTGGG + Intronic
1105538340 13:21291243-21291265 ACACCCAGGAATGAACAAGGAGG + Intergenic
1107799887 13:44095811-44095833 ACAATCTGGAATAATCAACTGGG - Intergenic
1108164681 13:47679686-47679708 ACAGCCAGGCATAATCAACAAGG + Intergenic
1119542474 14:75449796-75449818 AGACACAGGAAAAATCACCTTGG - Intronic
1120743643 14:88134417-88134439 ATACACATGAATTATCAACTGGG + Intergenic
1120970718 14:90204858-90204880 ACTCCCAGGACAAATCAGCTAGG - Intergenic
1122574755 14:102734841-102734863 ACACCCAGGAATTGGCAGCTGGG - Intergenic
1131404463 15:92153106-92153128 TGCCCCAGGAATAATCAACCAGG + Intronic
1131701721 15:94943821-94943843 CCACACAGGAATATTCTACTTGG + Intergenic
1132176795 15:99722191-99722213 ACACACAGCATTAATAAACTAGG - Intronic
1133867282 16:9655933-9655955 CCACCCAGGAATAACCCATTTGG - Intergenic
1139185932 16:64806099-64806121 ATCCCCAGGAAAAATAAACTGGG + Intergenic
1144203600 17:12963325-12963347 AGACCCAGGAAGAATCTACAAGG - Intronic
1148101718 17:45096253-45096275 ACTCCGGGGAATAATCAAATCGG - Exonic
1203166877 17_GL000205v2_random:105546-105568 ACACCCAGGAATAATCAACTGGG - Intergenic
1153090362 18:1335669-1335691 ACAGCCAGGAATCTTGAACTGGG + Intergenic
1153184215 18:2469151-2469173 ACATCCAAGAATAATCCACCTGG + Intergenic
1154276612 18:12966825-12966847 AAATCCTGGAATAATCAAATAGG - Intronic
1157599840 18:48887166-48887188 ACACACAGGAGTTCTCAACTAGG + Intergenic
1159761688 18:72434717-72434739 ACGCCAAGGCAGAATCAACTAGG + Intergenic
1160278856 18:77467650-77467672 ACACCTGGGAAAAATCCACTTGG + Intergenic
1162704834 19:12547689-12547711 CTACCCAGGAAGAACCAACTGGG + Intronic
1165762881 19:38332585-38332607 ACACCCACGTATCATCAACAGGG - Intergenic
1167713912 19:51128568-51128590 ACCCCCAGGACTAATCAGCTGGG + Intronic
1168376611 19:55885259-55885281 AATTCCAGGAATAATGAACTTGG - Intergenic
929119082 2:38469102-38469124 ATCCCCTGGAAAAATCAACTGGG - Intergenic
933242564 2:79939201-79939223 ACACTCAGACATAAACAACTTGG - Intronic
936561724 2:113544428-113544450 AGACTCAGGAATACTGAACTTGG + Intergenic
937394410 2:121522031-121522053 AGAAGCAGGAATAATTAACTTGG + Intronic
938648821 2:133359294-133359316 ACACACAGGAATATTGAAGTGGG - Intronic
938684660 2:133726454-133726476 CCACCCAGGAATAAGACACTAGG + Intergenic
940495451 2:154422721-154422743 ACACCAAGGAATGATCAAAGTGG + Intronic
941387713 2:164873556-164873578 ACACCCTGGATTAGTCATCTAGG + Intergenic
943365713 2:186965925-186965947 ACATCCAAGAATAAATAACTGGG - Intergenic
946581537 2:221133466-221133488 TCACCCAGGACTAGTCAACCCGG + Intergenic
948376500 2:237524557-237524579 ACACCCAGCCTTAATCAAGTGGG - Intronic
1169279656 20:4256257-4256279 AGACCTAGGAATACTCAATTTGG + Intergenic
1169645497 20:7804859-7804881 ATACACAGGCATAATCCACTAGG + Intergenic
1169859806 20:10139554-10139576 ACACCCAGGTAGAAGCTACTAGG + Intergenic
1170242094 20:14177843-14177865 ACACCCAAAAATAATGCACTAGG + Intronic
1170803395 20:19609258-19609280 ACACCAAGGAACAATTAACTTGG + Intronic
1173094195 20:40009098-40009120 ATACCCAGGGTTCATCAACTGGG - Intergenic
1176334686 21:5585011-5585033 ACACCCAGGAATAATCAACTGGG + Intergenic
1176393071 21:6235937-6235959 ACACCCAGGAATAATCAACTGGG - Intergenic
1176404878 21:6353551-6353573 ACACCCAGGAATAATCAACTGGG + Intergenic
1176432279 21:6635553-6635575 ACACCCAGGAATAATCAACTGGG - Intergenic
1176468348 21:7080237-7080259 ACACCCAGGAATAATCAACTGGG + Intronic
1176491909 21:7462015-7462037 ACACCCAGGAATAATCAACTGGG + Intergenic
1176508733 21:7676368-7676390 ACACCCAGGAATAATCAACTGGG - Intergenic
1178570661 21:33733097-33733119 ACACCCATGAATAACCAAGGGGG + Intronic
1178629507 21:34247119-34247141 ACACCCAAGAAGAATCACCTAGG - Intergenic
955597057 3:60602630-60602652 ACAACCAGGACTAAACAAATGGG + Intronic
956656557 3:71558390-71558412 ACTCACAGGAATAAGCAATTCGG + Intronic
962330499 3:134473699-134473721 TCATCCAGGAATAATCCATTAGG - Intergenic
962411967 3:135148951-135148973 ACTCCAAGGAAAAATCAACTAGG - Intronic
962838008 3:139205794-139205816 ACACCCAGGTAGTATCCACTTGG + Intronic
962918218 3:139927816-139927838 GCAGGCAGGAATAATCAAGTTGG + Intergenic
967762014 3:193236824-193236846 ATACCCAGGAATAATCAGTTTGG + Intergenic
969387434 4:6863960-6863982 ATTCCCAGGAGGAATCAACTGGG + Exonic
969552749 4:7881845-7881867 ACAACTAGGAAGAATCAGCTGGG - Intronic
970905007 4:21205403-21205425 ACACCAAAGAATTATCATCTTGG - Intronic
972204661 4:36757764-36757786 AAACTCATGAATAATCCACTTGG - Intergenic
973126665 4:46594179-46594201 AAACCCAGGAATAAAGAATTAGG - Intergenic
975425326 4:74218778-74218800 TCAACCAAGAATTATCAACTAGG - Intronic
980657466 4:135808359-135808381 ACAGCCATGTATAATTAACTGGG - Intergenic
989639496 5:43569316-43569338 ACTTCTAGGAATAAACAACTGGG + Intergenic
989744463 5:44811019-44811041 GCACCCAGTAAAAATGAACTGGG - Exonic
991141923 5:63254383-63254405 ACACCCATGAATAAAAAAATAGG - Intergenic
994635407 5:102339925-102339947 ACTTCCGGGAATAAACAACTGGG - Intergenic
995941200 5:117586838-117586860 AAAACAAGGAATAATCAATTTGG + Intergenic
1000787787 5:165567817-165567839 AACCCCATAAATAATCAACTAGG - Intergenic
1004953869 6:20705585-20705607 ACCCCCATGTATAAACAACTGGG + Intronic
1007546581 6:42698919-42698941 GCACCCAGGAATAATGCACCTGG - Intronic
1010057038 6:71578509-71578531 GCACCCAGTGATATTCAACTAGG - Intergenic
1015805839 6:137107488-137107510 ACACCCAGGAATACTATACTTGG - Intergenic
1022012138 7:26317584-26317606 ATACCTGGGAATAATTAACTTGG + Intronic
1023198171 7:37664839-37664861 ATACCCAGAAATTATCAACTAGG + Intergenic
1024566063 7:50681960-50681982 ACACTCAGGATTCATCAACCCGG - Intronic
1027262794 7:76477053-76477075 ACACCCAGGAGTAATTGGCTTGG + Intronic
1027314170 7:76975150-76975172 ACACCCAGGAGTAATTGGCTTGG + Intergenic
1028167886 7:87560075-87560097 ACAACCACAAATAATCAAATAGG - Intronic
1029929758 7:104358309-104358331 ACACACAGTAATAATACACTTGG - Intronic
1033553434 7:142468243-142468265 AAACGCTGGAATCATCAACTGGG - Intergenic
1034288706 7:149909648-149909670 ACATGAAGGAATAATGAACTGGG + Intergenic
1034662371 7:152783222-152783244 ACATGAAGGAATAATGAACTGGG - Exonic
1037059922 8:14495049-14495071 ATGCCCATGAAGAATCAACTGGG - Intronic
1038103205 8:24403329-24403351 ATACCTAGGAATAATAAACTGGG - Intronic
1045106569 8:98898387-98898409 ACACCCTGGTCTAATCAGCTAGG + Intronic
1045622085 8:103991008-103991030 ATACCAAGGATTAATCATCTAGG - Intronic
1046382338 8:113467653-113467675 ATACCCAGCAAAAATCAAATTGG + Intergenic
1047124244 8:121942900-121942922 ACACCCAGAAATACACAATTTGG + Intergenic
1049890957 9:70886-70908 AGACTCAGGAATACTGAACTTGG - Intergenic
1050461100 9:5878203-5878225 ACATTAAGGAATAATCAACATGG + Intergenic
1053732420 9:41072083-41072105 AGACTCAGGAATACTGAACTTGG - Intergenic
1054696032 9:68359635-68359657 AGACTCAGGAATACTGAACTTGG + Intronic
1055818552 9:80235332-80235354 TTACCCAGGCATAATCAACATGG + Intergenic
1056690175 9:88801548-88801570 GGACCCAGGAATATTCCACTGGG - Intergenic
1058818504 9:108707368-108707390 ACACCCAGGGTTAAGCAGCTTGG - Intergenic
1059588992 9:115637190-115637212 ACACCCAGTAATATTCTAATGGG - Intergenic
1060912974 9:127365457-127365479 AAACCCAGGAATGATACACTGGG - Intronic
1203439259 Un_GL000195v1:173159-173181 ACACCCAGGAATAATCAACTGGG + Intergenic
1186815804 X:13236997-13237019 ACACCCAGGAGTAATGAACTAGG + Intergenic
1187283240 X:17878904-17878926 ATATCCAGGAATACTCAATTGGG - Intergenic
1189159367 X:38795163-38795185 ACTCCCAAGAATCATCAATTTGG + Intergenic
1193774764 X:85628263-85628285 GCACCAAGGGATAATCCACTGGG + Intergenic
1197252999 X:124234292-124234314 ACACCCAGGAATGAACAGGTTGG - Intronic
1199687728 X:150279551-150279573 ACACACAGGCATATTCAACAAGG - Intergenic