ID: 1176468351

View in Genome Browser
Species Human (GRCh38)
Location 21:7080247-7080269
Sequence ATAATCAACTGGGCCTTCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 9, 1: 1, 2: 0, 3: 17, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176468341_1176468351 27 Left 1176468341 21:7080197-7080219 CCATGGTTGGTGTGAGTAGGCTT 0: 5
1: 1
2: 0
3: 9
4: 105
Right 1176468351 21:7080247-7080269 ATAATCAACTGGGCCTTCAGTGG 0: 9
1: 1
2: 0
3: 17
4: 139
1176468346_1176468351 -1 Left 1176468346 21:7080225-7080247 CCTGCAGGGCAGACACCCAGGAA 0: 6
1: 0
2: 5
3: 47
4: 383
Right 1176468351 21:7080247-7080269 ATAATCAACTGGGCCTTCAGTGG 0: 9
1: 1
2: 0
3: 17
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176468351 Original CRISPR ATAATCAACTGGGCCTTCAG TGG Intronic
901723483 1:11219554-11219576 ATATTCAACTGGGCTTTCCCTGG - Intronic
902753034 1:18530720-18530742 ATAAGCAACTGTGCCATCAGGGG - Intergenic
904370613 1:30045458-30045480 CCAATCAACTGGGCTTTCAGGGG + Intergenic
904417683 1:30373157-30373179 CCAATCAACTGGGCTTTCATGGG - Intergenic
914345513 1:146795237-146795259 CTACTCCACTTGGCCTTCAGAGG + Intergenic
914998875 1:152569368-152569390 AAAATTAACAGAGCCTTCAGAGG - Intronic
916169512 1:161990563-161990585 ATGATCATCTAAGCCTTCAGTGG + Intronic
917973721 1:180225306-180225328 ATAATGAAAGGGGCCTTGAGAGG + Intergenic
918499639 1:185179659-185179681 GTAAACAAGTTGGCCTTCAGTGG - Intronic
924042414 1:239997482-239997504 GTCACCACCTGGGCCTTCAGAGG + Intergenic
1063688398 10:8260182-8260204 ATAATAATCTGGGCTTTCACGGG + Intergenic
1064607986 10:17064154-17064176 ATAATGAACTGCTCCTGCAGAGG + Intronic
1069136705 10:64776219-64776241 ATAATAAACTGAGCATTCATTGG - Intergenic
1069334970 10:67337778-67337800 ATGATCATTTGAGCCTTCAGTGG - Intronic
1072899186 10:99392451-99392473 ATAATCTCATGGGACTTCAGTGG + Exonic
1074468250 10:113704050-113704072 ACAATCATTTGAGCCTTCAGTGG - Intronic
1077597791 11:3548987-3549009 ATGAGGAACTGAGCCTTCAGAGG - Intergenic
1082232742 11:49788632-49788654 CTGATCATCTGAGCCTTCAGTGG + Intergenic
1085575799 11:77601436-77601458 AGAATAAACTGAGCCTGCAGAGG - Intronic
1085675638 11:78514991-78515013 ATCATGAAGGGGGCCTTCAGTGG + Intronic
1085790715 11:79494862-79494884 ATAATCATCTGGGCATTTTGTGG - Intergenic
1086617887 11:88845295-88845317 GTGATCATCTGAGCCTTCAGTGG - Intronic
1086624992 11:88939211-88939233 GTAAACAATTAGGCCTTCAGTGG - Intronic
1088187695 11:107191267-107191289 CTATTCAGGTGGGCCTTCAGTGG + Intergenic
1093860398 12:24158724-24158746 AAAATCACATAGGCCTTCAGAGG - Intergenic
1095565399 12:43617660-43617682 TTAATCAACTTTGCATTCAGGGG + Intergenic
1095794879 12:46207746-46207768 ATAGTCATTTTGGCCTTCAGGGG + Intronic
1096296422 12:50388101-50388123 ATAAGCAGCTTGACCTTCAGCGG + Intronic
1096456690 12:51793239-51793261 AGAATCAACAGGCCCTTCAGTGG + Intronic
1097271967 12:57781146-57781168 AAGATCATCTGGGCCTTCAGAGG - Exonic
1099233910 12:80059284-80059306 TTATTCAACTGGAGCTTCAGGGG + Intergenic
1101286964 12:103324744-103324766 ATAATCACCTGGTCCTAGAGTGG - Intronic
1107176250 13:37402539-37402561 ATGATCATCTGAGCCTTCAGTGG - Intergenic
1108556117 13:51594504-51594526 ATAATCAGCAGGGCCTGCTGTGG + Intronic
1112243305 13:97703580-97703602 ATAATCAACTGGTCTCTAAGTGG + Intergenic
1113101897 13:106729311-106729333 ATAAGCAACTAGACTTTCAGCGG + Intergenic
1114827839 14:26103338-26103360 AAAAACACCTTGGCCTTCAGTGG + Intergenic
1114829492 14:26122579-26122601 ACTATCAACAGGGCCTCCAGAGG - Intergenic
1115708283 14:36020973-36020995 AAAATCCATTGGGCTTTCAGTGG - Intergenic
1117525026 14:56592365-56592387 ATAATCTACTGCTCTTTCAGTGG + Intronic
1117818654 14:59624906-59624928 ATTATGAGTTGGGCCTTCAGTGG - Intronic
1118234689 14:63991820-63991842 ATAATGAGCTGGGCATTTAGGGG + Intronic
1118280935 14:64427953-64427975 AGCAGCAACTGGGACTTCAGAGG + Intronic
1119091737 14:71788891-71788913 TAAATCATCTGAGCCTTCAGTGG - Intergenic
1119471632 14:74903822-74903844 ATAAGCAACAGGACCTTGAGTGG - Intergenic
1122853735 14:104549914-104549936 ATTATCTCCTGGGCCTTCTGGGG + Intronic
1125385295 15:39130524-39130546 ATAAGCTACTGGGCCAGCAGAGG + Intergenic
1125425480 15:39544291-39544313 ATAATCAGCTTGGCCTACAGAGG - Intergenic
1127568353 15:60215383-60215405 ATACTGAACTGGGCCTCCAGGGG + Intergenic
1128792513 15:70443519-70443541 AGATTAAACTGGACCTTCAGAGG - Intergenic
1130672032 15:85921131-85921153 ATAATGAACTGGGCCTTGCAGGG + Intergenic
1131114172 15:89784037-89784059 ATGTTCAACTGGGCCTTGCGGGG + Intergenic
1131943835 15:97597433-97597455 ATAATCAACAGGGTCCTCAACGG + Intergenic
1133391048 16:5410280-5410302 AGAATCACCTGTGCCCTCAGAGG + Intergenic
1134371561 16:13630740-13630762 ATAATCACCTGTGACTTAAGAGG - Intergenic
1138315777 16:56068855-56068877 ATAATCAACTGGGCCTACTTGGG - Intergenic
1139988473 16:70920026-70920048 CTACTCCACTTGGCCTTCAGAGG - Intronic
1140629912 16:76838966-76838988 ATAATCAAATGGTCCATCATTGG + Intergenic
1140808660 16:78556375-78556397 ATCACCAACTGGGACTTGAGAGG + Intronic
1141314990 16:82953700-82953722 ATAATGAACTGGGTGCTCAGTGG + Intronic
1143582772 17:7836165-7836187 AGAATCACCTGGGCCGTCCGGGG - Intergenic
1144016171 17:11198642-11198664 AGAACAAACTGGGGCTTCAGAGG + Intergenic
1145253094 17:21307167-21307189 ATAATCAGCTGGGTTTTCTGGGG + Intronic
1146310563 17:31765203-31765225 AGAATCAACTGACCCTTGAGTGG - Intergenic
1151767210 17:76138684-76138706 ATAATCAACTGAGCCTGGAGTGG - Intronic
1203166874 17_GL000205v2_random:105536-105558 ATAATCAACTGGGCCTTCAGTGG - Intergenic
1153675267 18:7451479-7451501 AGAATCAACTAGGCATTCGGCGG - Intergenic
1156221986 18:35062027-35062049 ATAATGAACTGGGCTTCCATAGG - Intronic
1156444867 18:37228852-37228874 AGGATCATCTGAGCCTTCAGTGG - Intronic
1159756127 18:72368582-72368604 ACGATGAACTGGGCATTCAGTGG + Intergenic
1164722101 19:30439827-30439849 TTCAGCAACTGGGCCATCAGGGG + Intronic
1166338927 19:42125756-42125778 ATAAACAACCTGGCCTCCAGGGG + Intronic
1167491805 19:49797083-49797105 ATTACCAGCTGGGCCTTCTGGGG - Intronic
1168277956 19:55287418-55287440 GCAAGGAACTGGGCCTTCAGCGG - Intronic
925601974 2:5617377-5617399 AAACTCAATTTGGCCTTCAGTGG - Intergenic
925955130 2:8955912-8955934 AGGATCATCTGGGCCTTCAGTGG - Intronic
928798986 2:35063857-35063879 AGAATCAACTGAGCCTTGAGAGG - Intergenic
932950902 2:76291848-76291870 ATGATCATCTGAGCCTTCAGTGG + Intergenic
936514773 2:113174580-113174602 AGAGTCAACTTGGCCATCAGGGG + Intronic
937055030 2:118927402-118927424 CTAATCACCTGGGCCTCCTGAGG + Intergenic
941467489 2:165846255-165846277 ATAATCAACTAGGATTACAGAGG + Intergenic
943949504 2:194114033-194114055 ATGATCATCTGAGCCTTCATCGG + Intergenic
944132821 2:196365032-196365054 ATAATCAGGTGGGCTTGCAGTGG - Intronic
945646933 2:212508094-212508116 ACAATCATCTGAGCCTTCAATGG - Intronic
946264991 2:218532586-218532608 ACAATCATCTGAACCTTCAGAGG - Intronic
946460938 2:219868360-219868382 ATAATTAACAGGGGCTTGAGTGG - Intergenic
946524366 2:220502528-220502550 ACAATCATCTGAGCCTTAAGGGG - Intergenic
947130404 2:226916965-226916987 AAAATCACCAGGGCCATCAGAGG - Intronic
948654182 2:239466483-239466505 CTAATCAACTGGGCCTGGAGCGG + Intergenic
1172789972 20:37496355-37496377 CTAATCCACTGGGACATCAGTGG - Intronic
1172821048 20:37734651-37734673 TTCATCAAATGGGACTTCAGTGG - Intronic
1173491339 20:43484979-43485001 AGGATCACCTGAGCCTTCAGAGG + Intergenic
1174351152 20:49969192-49969214 AAATTTAACTGGGCCTTCTGTGG - Intergenic
1176334689 21:5585021-5585043 ATAATCAACTGGGCCTTCAGTGG + Intergenic
1176393068 21:6235927-6235949 ATAATCAACTGGGCCTTCAGTGG - Intergenic
1176404881 21:6353561-6353583 ATAATCAACTGGGCCTTCAGTGG + Intergenic
1176432276 21:6635543-6635565 ATAATCAACTGGGCCTTCAGTGG - Intergenic
1176468351 21:7080247-7080269 ATAATCAACTGGGCCTTCAGTGG + Intronic
1176491912 21:7462025-7462047 ATAATCAACTGGGCCTTCAGTGG + Intergenic
1176508730 21:7676358-7676380 ATAATCAACTGGGCCTTCAGTGG - Intergenic
1178400536 21:32281339-32281361 ACAAGCAACTGGGACTACAGGGG - Intergenic
1179149395 21:38797007-38797029 ATCCTCTACTGGGGCTTCAGAGG - Intergenic
1181278783 22:21703737-21703759 AGAATCACCTGGGTCTTTAGGGG - Intronic
1181338240 22:22157542-22157564 AGAATCAAGTGGGCATCCAGGGG - Intergenic
1184869042 22:47221946-47221968 ATCCTCTCCTGGGCCTTCAGAGG + Intergenic
950788123 3:15452460-15452482 ATGATCATCCGGGCCTACAGAGG - Intronic
956208087 3:66774672-66774694 AAAATGGACTGGGTCTTCAGTGG - Intergenic
961285207 3:125796613-125796635 ATGAGCAACTGAGCTTTCAGAGG + Intergenic
961373883 3:126449779-126449801 AGAATGAACTGGACCTGCAGAGG + Intronic
966351417 3:179036066-179036088 ATAAAGAACTTGGACTTCAGAGG + Intronic
969012298 4:4075965-4075987 ATAAGGAACTGAGCTTTCAGAGG - Intergenic
969608404 4:8213598-8213620 ATAAGAAATGGGGCCTTCAGCGG + Intronic
971350048 4:25847355-25847377 ATCATCAAGTGTGCCTTGAGTGG - Exonic
971695017 4:29889861-29889883 ACGATCAACTGAGCCTTCAGTGG + Intergenic
971790095 4:31158997-31159019 ATAATCTACTGCTGCTTCAGAGG + Intergenic
978302193 4:107283011-107283033 ATAATCAACTGGGAGTTAGGAGG - Intronic
982640980 4:157960137-157960159 TTAAACAACTGGCTCTTCAGTGG + Intergenic
984385276 4:179047908-179047930 ATCATGAACTGCGCATTCAGGGG - Intergenic
986559566 5:9046859-9046881 ATTATCCACTGGCACTTCAGTGG - Intronic
987095743 5:14547767-14547789 ACAATTATCTGAGCCTTCAGTGG + Intergenic
987935160 5:24454078-24454100 AGAATCACCTGAGCCTGCAGAGG + Intergenic
990221000 5:53588258-53588280 ACGATCATCTGAGCCTTCAGTGG + Intronic
992836207 5:80643918-80643940 ACAATCATCCGAGCCTTCAGTGG - Intronic
995982356 5:118119609-118119631 ATAATCAATTGGTCAGTCAGTGG + Intergenic
1000320455 5:160130407-160130429 ATAATCACCTGGGCCCTGGGAGG - Intergenic
1001001173 5:168008544-168008566 ATTATTGACGGGGCCTTCAGAGG - Intronic
1001283181 5:170402719-170402741 AGAAGCCACTGAGCCTTCAGGGG - Intronic
1006933506 6:37701610-37701632 TTAATAAACTGGTCTTTCAGCGG - Intergenic
1010618045 6:78037834-78037856 ATAATACACTGTGCCTTCACAGG - Intergenic
1012472192 6:99584584-99584606 ATGATCACCTGAGCCTTCAGTGG + Intergenic
1015337152 6:132052846-132052868 ATCATCATCTGAGACTTCAGCGG - Intergenic
1019952358 7:4383894-4383916 ATAATGAATTGTTCCTTCAGAGG + Intergenic
1026521922 7:71124989-71125011 ATTTTAAACTGGGCCTTAAGAGG + Intergenic
1028229570 7:88290495-88290517 ACCATCAACTAGGCCATCAGAGG + Intronic
1028646357 7:93101346-93101368 ATAAGCAAGTGGGCCTCCAATGG + Exonic
1028708238 7:93875418-93875440 TAAATCAGCTGGTCCTTCAGAGG - Intronic
1029881388 7:103814662-103814684 ATGATCCTCTGGGCCCTCAGAGG - Intronic
1031318049 7:120282159-120282181 ATAAGGAACTGGGCTTTCAAGGG - Intronic
1036570104 8:9972820-9972842 ATTGACAACTGGGCATTCAGCGG + Intergenic
1036668982 8:10767350-10767372 ATGGACAATTGGGCCTTCAGTGG + Intronic
1036734679 8:11301350-11301372 AAAATCAACTGAGCATTAAGGGG - Intronic
1039940521 8:42086460-42086482 ACAATCATCTGAGCCTTCAGTGG + Intergenic
1040549707 8:48428681-48428703 ACAATCAGCTGGGCCCTCTGTGG + Intergenic
1040909620 8:52504593-52504615 ATAATCATCAGGGCCTATAGAGG + Intergenic
1042685804 8:71439112-71439134 AGAATCATCTGGGCCTTTACTGG - Intronic
1042834332 8:73064471-73064493 ACAAACACCTGGGCCTTCTGAGG - Intergenic
1043760220 8:84059051-84059073 ATAATCAGCTGGGCATGCTGGGG + Intergenic
1044546436 8:93465525-93465547 ATAGTCAACTGGAACTTAAGGGG - Intergenic
1047860521 8:128961228-128961250 ATAAGCACCTGGGGCTTTAGAGG + Intergenic
1050529072 9:6572381-6572403 AAAATCAACTGGGTTTTCATTGG + Intronic
1051138856 9:13955458-13955480 ATAATAAACTGGGGTTTCACCGG - Intergenic
1051594492 9:18810829-18810851 ATAATGTACAGGGCCTTTAGTGG - Intronic
1056181524 9:84088031-84088053 ACAATCATCTGAGCCTTTAGTGG + Intergenic
1057001927 9:91517960-91517982 ATGATCATCAGAGCCTTCAGGGG + Intergenic
1058754597 9:108072738-108072760 ACAATCAACAGATCCTTCAGAGG + Intergenic
1060989337 9:127839182-127839204 ATCAGCAAATGGGGCTTCAGGGG - Intronic
1203426949 Un_GL000195v1:49899-49921 ATAATCAACTGAGCCTTCAGTGG - Intergenic
1203439262 Un_GL000195v1:173169-173191 ATAATCAACTGGGCCTTCAGTGG + Intergenic
1187034980 X:15528906-15528928 CTAATCAAAAGGCCCTTCAGGGG - Intronic
1189033308 X:37471225-37471247 ATCATCAACTGGTCCCTCAATGG + Intronic
1194386638 X:93263618-93263640 ATAATCAACCTGGCCTCTAGTGG + Intergenic
1194581016 X:95671035-95671057 ATGATCATCTGAGCCTTCAGTGG + Intergenic
1194809403 X:98372403-98372425 ATAATCAACTTGGCCCGAAGAGG - Intergenic
1201194524 Y:11478825-11478847 TTAATCAACTGGGACTTAAATGG - Intergenic
1201309611 Y:12584500-12584522 AGAATCATCTGAGCCTCCAGAGG + Intergenic
1201380618 Y:13373839-13373861 ATAATAAAATGTGCTTTCAGAGG - Intronic