ID: 1176469653

View in Genome Browser
Species Human (GRCh38)
Location 21:7095943-7095965
Sequence TCCCGATGTTGGGGGAGCGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176469653_1176469658 6 Left 1176469653 21:7095943-7095965 CCAACGCTCCCCCAACATCGGGA No data
Right 1176469658 21:7095972-7095994 AAACAAATTTCCTTTTTTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176469653 Original CRISPR TCCCGATGTTGGGGGAGCGT TGG (reversed) Intergenic
No off target data available for this crispr