ID: 1176469958

View in Genome Browser
Species Human (GRCh38)
Location 21:7098014-7098036
Sequence TAGTCTAAGGAGAAAGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176469955_1176469958 -3 Left 1176469955 21:7097994-7098016 CCAGCTCAGTGACAGTGCGCTAG No data
Right 1176469958 21:7098014-7098036 TAGTCTAAGGAGAAAGAGGCAGG No data
1176469953_1176469958 9 Left 1176469953 21:7097982-7098004 CCTAGCATGCACCCAGCTCAGTG No data
Right 1176469958 21:7098014-7098036 TAGTCTAAGGAGAAAGAGGCAGG No data
1176469954_1176469958 -2 Left 1176469954 21:7097993-7098015 CCCAGCTCAGTGACAGTGCGCTA No data
Right 1176469958 21:7098014-7098036 TAGTCTAAGGAGAAAGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176469958 Original CRISPR TAGTCTAAGGAGAAAGAGGC AGG Intergenic
No off target data available for this crispr