ID: 1176470291

View in Genome Browser
Species Human (GRCh38)
Location 21:7100099-7100121
Sequence CAGCTTCAGAATTCTGTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176470286_1176470291 -3 Left 1176470286 21:7100079-7100101 CCACGTGGCCTGCTTATGAACAG No data
Right 1176470291 21:7100099-7100121 CAGCTTCAGAATTCTGTAGGGGG No data
1176470284_1176470291 29 Left 1176470284 21:7100047-7100069 CCTCATGCTCAACAGCTTTTGAG No data
Right 1176470291 21:7100099-7100121 CAGCTTCAGAATTCTGTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176470291 Original CRISPR CAGCTTCAGAATTCTGTAGG GGG Intergenic
No off target data available for this crispr