ID: 1176472508

View in Genome Browser
Species Human (GRCh38)
Location 21:7119283-7119305
Sequence TTGCAGCCCTACCACTGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176472508_1176472509 5 Left 1176472508 21:7119283-7119305 CCTTTTCAGTGGTAGGGCTGCAA No data
Right 1176472509 21:7119311-7119333 AGTATTTTAGCGTTAGCCTTTGG No data
1176472508_1176472510 13 Left 1176472508 21:7119283-7119305 CCTTTTCAGTGGTAGGGCTGCAA No data
Right 1176472510 21:7119319-7119341 AGCGTTAGCCTTTGGTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176472508 Original CRISPR TTGCAGCCCTACCACTGAAA AGG (reversed) Intergenic
No off target data available for this crispr