ID: 1176472669

View in Genome Browser
Species Human (GRCh38)
Location 21:7121427-7121449
Sequence TCTCTGAGTAGACCAATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176472667_1176472669 7 Left 1176472667 21:7121397-7121419 CCTCCAAGACTAAACGAGGAAGA No data
Right 1176472669 21:7121427-7121449 TCTCTGAGTAGACCAATAGCAGG No data
1176472665_1176472669 12 Left 1176472665 21:7121392-7121414 CCACACCTCCAAGACTAAACGAG No data
Right 1176472669 21:7121427-7121449 TCTCTGAGTAGACCAATAGCAGG No data
1176472664_1176472669 23 Left 1176472664 21:7121381-7121403 CCTGGAAACATCCACACCTCCAA No data
Right 1176472669 21:7121427-7121449 TCTCTGAGTAGACCAATAGCAGG No data
1176472668_1176472669 4 Left 1176472668 21:7121400-7121422 CCAAGACTAAACGAGGAAGAAGT 0: 63
1: 8146
2: 3955
3: 2093
4: 2188
Right 1176472669 21:7121427-7121449 TCTCTGAGTAGACCAATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176472669 Original CRISPR TCTCTGAGTAGACCAATAGC AGG Intergenic
No off target data available for this crispr