ID: 1176473565

View in Genome Browser
Species Human (GRCh38)
Location 21:7130345-7130367
Sequence TCGATTGTCCCCGTGTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176473565_1176473571 15 Left 1176473565 21:7130345-7130367 CCCTCAAACACGGGGACAATCGA No data
Right 1176473571 21:7130383-7130405 TAATAACAGAGAATGCCGGAAGG No data
1176473565_1176473570 11 Left 1176473565 21:7130345-7130367 CCCTCAAACACGGGGACAATCGA No data
Right 1176473570 21:7130379-7130401 CGAGTAATAACAGAGAATGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176473565 Original CRISPR TCGATTGTCCCCGTGTTTGA GGG (reversed) Intergenic
No off target data available for this crispr