ID: 1176483254

View in Genome Browser
Species Human (GRCh38)
Location 21:7379183-7379205
Sequence GGCCCATCCGGTCCTGTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176483254_1176483262 -7 Left 1176483254 21:7379183-7379205 CCAGGGACAGGACCGGATGGGCC No data
Right 1176483262 21:7379199-7379221 ATGGGCCGGACGGGACGTGGGGG No data
1176483254_1176483261 -8 Left 1176483254 21:7379183-7379205 CCAGGGACAGGACCGGATGGGCC No data
Right 1176483261 21:7379198-7379220 GATGGGCCGGACGGGACGTGGGG No data
1176483254_1176483265 14 Left 1176483254 21:7379183-7379205 CCAGGGACAGGACCGGATGGGCC No data
Right 1176483265 21:7379220-7379242 GGTCCTCGCTGCTGGCCCAGCGG No data
1176483254_1176483264 6 Left 1176483254 21:7379183-7379205 CCAGGGACAGGACCGGATGGGCC No data
Right 1176483264 21:7379212-7379234 GACGTGGGGGTCCTCGCTGCTGG No data
1176483254_1176483259 -10 Left 1176483254 21:7379183-7379205 CCAGGGACAGGACCGGATGGGCC No data
Right 1176483259 21:7379196-7379218 CGGATGGGCCGGACGGGACGTGG No data
1176483254_1176483260 -9 Left 1176483254 21:7379183-7379205 CCAGGGACAGGACCGGATGGGCC No data
Right 1176483260 21:7379197-7379219 GGATGGGCCGGACGGGACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176483254 Original CRISPR GGCCCATCCGGTCCTGTCCC TGG (reversed) Intergenic