ID: 1176483258

View in Genome Browser
Species Human (GRCh38)
Location 21:7379195-7379217
Sequence CACGTCCCGTCCGGCCCATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176483258_1176483264 -6 Left 1176483258 21:7379195-7379217 CCGGATGGGCCGGACGGGACGTG No data
Right 1176483264 21:7379212-7379234 GACGTGGGGGTCCTCGCTGCTGG No data
1176483258_1176483271 22 Left 1176483258 21:7379195-7379217 CCGGATGGGCCGGACGGGACGTG No data
Right 1176483271 21:7379240-7379262 CGGCCATCTTGCAGCCACAGGGG No data
1176483258_1176483265 2 Left 1176483258 21:7379195-7379217 CCGGATGGGCCGGACGGGACGTG No data
Right 1176483265 21:7379220-7379242 GGTCCTCGCTGCTGGCCCAGCGG No data
1176483258_1176483274 30 Left 1176483258 21:7379195-7379217 CCGGATGGGCCGGACGGGACGTG No data
Right 1176483274 21:7379248-7379270 TTGCAGCCACAGGGGACTGAGGG No data
1176483258_1176483269 20 Left 1176483258 21:7379195-7379217 CCGGATGGGCCGGACGGGACGTG No data
Right 1176483269 21:7379238-7379260 AGCGGCCATCTTGCAGCCACAGG No data
1176483258_1176483273 29 Left 1176483258 21:7379195-7379217 CCGGATGGGCCGGACGGGACGTG No data
Right 1176483273 21:7379247-7379269 CTTGCAGCCACAGGGGACTGAGG No data
1176483258_1176483270 21 Left 1176483258 21:7379195-7379217 CCGGATGGGCCGGACGGGACGTG No data
Right 1176483270 21:7379239-7379261 GCGGCCATCTTGCAGCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176483258 Original CRISPR CACGTCCCGTCCGGCCCATC CGG (reversed) Intergenic