ID: 1176483263

View in Genome Browser
Species Human (GRCh38)
Location 21:7379204-7379226
Sequence GAGGACCCCCACGTCCCGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176483263_1176483265 -7 Left 1176483263 21:7379204-7379226 CCGGACGGGACGTGGGGGTCCTC No data
Right 1176483265 21:7379220-7379242 GGTCCTCGCTGCTGGCCCAGCGG No data
1176483263_1176483269 11 Left 1176483263 21:7379204-7379226 CCGGACGGGACGTGGGGGTCCTC No data
Right 1176483269 21:7379238-7379260 AGCGGCCATCTTGCAGCCACAGG No data
1176483263_1176483270 12 Left 1176483263 21:7379204-7379226 CCGGACGGGACGTGGGGGTCCTC No data
Right 1176483270 21:7379239-7379261 GCGGCCATCTTGCAGCCACAGGG No data
1176483263_1176483271 13 Left 1176483263 21:7379204-7379226 CCGGACGGGACGTGGGGGTCCTC No data
Right 1176483271 21:7379240-7379262 CGGCCATCTTGCAGCCACAGGGG No data
1176483263_1176483273 20 Left 1176483263 21:7379204-7379226 CCGGACGGGACGTGGGGGTCCTC No data
Right 1176483273 21:7379247-7379269 CTTGCAGCCACAGGGGACTGAGG No data
1176483263_1176483274 21 Left 1176483263 21:7379204-7379226 CCGGACGGGACGTGGGGGTCCTC No data
Right 1176483274 21:7379248-7379270 TTGCAGCCACAGGGGACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176483263 Original CRISPR GAGGACCCCCACGTCCCGTC CGG (reversed) Intergenic