ID: 1176483264

View in Genome Browser
Species Human (GRCh38)
Location 21:7379212-7379234
Sequence GACGTGGGGGTCCTCGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176483254_1176483264 6 Left 1176483254 21:7379183-7379205 CCAGGGACAGGACCGGATGGGCC No data
Right 1176483264 21:7379212-7379234 GACGTGGGGGTCCTCGCTGCTGG No data
1176483253_1176483264 7 Left 1176483253 21:7379182-7379204 CCCAGGGACAGGACCGGATGGGC No data
Right 1176483264 21:7379212-7379234 GACGTGGGGGTCCTCGCTGCTGG No data
1176483258_1176483264 -6 Left 1176483258 21:7379195-7379217 CCGGATGGGCCGGACGGGACGTG No data
Right 1176483264 21:7379212-7379234 GACGTGGGGGTCCTCGCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176483264 Original CRISPR GACGTGGGGGTCCTCGCTGC TGG Intergenic