ID: 1176483264 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:7379212-7379234 |
Sequence | GACGTGGGGGTCCTCGCTGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1176483254_1176483264 | 6 | Left | 1176483254 | 21:7379183-7379205 | CCAGGGACAGGACCGGATGGGCC | No data | ||
Right | 1176483264 | 21:7379212-7379234 | GACGTGGGGGTCCTCGCTGCTGG | No data | ||||
1176483253_1176483264 | 7 | Left | 1176483253 | 21:7379182-7379204 | CCCAGGGACAGGACCGGATGGGC | No data | ||
Right | 1176483264 | 21:7379212-7379234 | GACGTGGGGGTCCTCGCTGCTGG | No data | ||||
1176483258_1176483264 | -6 | Left | 1176483258 | 21:7379195-7379217 | CCGGATGGGCCGGACGGGACGTG | No data | ||
Right | 1176483264 | 21:7379212-7379234 | GACGTGGGGGTCCTCGCTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1176483264 | Original CRISPR | GACGTGGGGGTCCTCGCTGC TGG | Intergenic | ||