ID: 1176483265

View in Genome Browser
Species Human (GRCh38)
Location 21:7379220-7379242
Sequence GGTCCTCGCTGCTGGCCCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176483253_1176483265 15 Left 1176483253 21:7379182-7379204 CCCAGGGACAGGACCGGATGGGC No data
Right 1176483265 21:7379220-7379242 GGTCCTCGCTGCTGGCCCAGCGG No data
1176483254_1176483265 14 Left 1176483254 21:7379183-7379205 CCAGGGACAGGACCGGATGGGCC No data
Right 1176483265 21:7379220-7379242 GGTCCTCGCTGCTGGCCCAGCGG No data
1176483263_1176483265 -7 Left 1176483263 21:7379204-7379226 CCGGACGGGACGTGGGGGTCCTC No data
Right 1176483265 21:7379220-7379242 GGTCCTCGCTGCTGGCCCAGCGG No data
1176483258_1176483265 2 Left 1176483258 21:7379195-7379217 CCGGATGGGCCGGACGGGACGTG No data
Right 1176483265 21:7379220-7379242 GGTCCTCGCTGCTGGCCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176483265 Original CRISPR GGTCCTCGCTGCTGGCCCAG CGG Intergenic