ID: 1176484543

View in Genome Browser
Species Human (GRCh38)
Location 21:7388614-7388636
Sequence CAGAGGAAAAAGGAGCATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176484543_1176484556 24 Left 1176484543 21:7388614-7388636 CCTCCATGCTCCTTTTTCCTCTG No data
Right 1176484556 21:7388661-7388683 CGCAACTCTCAGGTCACCATTGG No data
1176484543_1176484552 14 Left 1176484543 21:7388614-7388636 CCTCCATGCTCCTTTTTCCTCTG No data
Right 1176484552 21:7388651-7388673 CAATGCCTCCCGCAACTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176484543 Original CRISPR CAGAGGAAAAAGGAGCATGG AGG (reversed) Intergenic
No off target data available for this crispr