ID: 1176488024

View in Genome Browser
Species Human (GRCh38)
Location 21:7424011-7424033
Sequence AAGTAGACACAAATCCCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176488024_1176488030 26 Left 1176488024 21:7424011-7424033 CCCATGGGGATTTGTGTCTACTT No data
Right 1176488030 21:7424060-7424082 TACAGGTGACTGTGCCGAGGTGG No data
1176488024_1176488031 27 Left 1176488024 21:7424011-7424033 CCCATGGGGATTTGTGTCTACTT No data
Right 1176488031 21:7424061-7424083 ACAGGTGACTGTGCCGAGGTGGG No data
1176488024_1176488029 23 Left 1176488024 21:7424011-7424033 CCCATGGGGATTTGTGTCTACTT No data
Right 1176488029 21:7424057-7424079 CACTACAGGTGACTGTGCCGAGG No data
1176488024_1176488028 9 Left 1176488024 21:7424011-7424033 CCCATGGGGATTTGTGTCTACTT No data
Right 1176488028 21:7424043-7424065 TGCTCATCTCAGTACACTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176488024 Original CRISPR AAGTAGACACAAATCCCCAT GGG (reversed) Intergenic
No off target data available for this crispr