ID: 1176488371

View in Genome Browser
Species Human (GRCh38)
Location 21:7426382-7426404
Sequence ATGTGAAAAGAGCTGGTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1176488371_1176488375 -2 Left 1176488371 21:7426382-7426404 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176488375 21:7426403-7426425 ATCATTTGAGGTAAGACGATGGG No data
1176488371_1176488374 -3 Left 1176488371 21:7426382-7426404 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176488374 21:7426402-7426424 CATCATTTGAGGTAAGACGATGG No data
1176488371_1176488377 0 Left 1176488371 21:7426382-7426404 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176488377 21:7426405-7426427 CATTTGAGGTAAGACGATGGGGG No data
1176488371_1176488376 -1 Left 1176488371 21:7426382-7426404 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176488376 21:7426404-7426426 TCATTTGAGGTAAGACGATGGGG No data
1176488371_1176488378 29 Left 1176488371 21:7426382-7426404 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176488378 21:7426434-7426456 CTCCAGAAGTCACACTGCGCTGG No data
1176488371_1176488379 30 Left 1176488371 21:7426382-7426404 CCGGGAACCAGCTCTTTTCACAT No data
Right 1176488379 21:7426435-7426457 TCCAGAAGTCACACTGCGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1176488371 Original CRISPR ATGTGAAAAGAGCTGGTTCC CGG (reversed) Intergenic
No off target data available for this crispr